ID: 1049832834

View in Genome Browser
Species Human (GRCh38)
Location 8:144713257-144713279
Sequence GCAGTGCTCCTTTCGGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049832821_1049832834 18 Left 1049832821 8:144713216-144713238 CCGGTGCGCTCCCAACAGGTTTC No data
Right 1049832834 8:144713257-144713279 GCAGTGCTCCTTTCGGCTCCAGG 0: 1
1: 0
2: 2
3: 13
4: 145
1049832828_1049832834 -4 Left 1049832828 8:144713238-144713260 CCGCCCGGGGTCACCGGCCGCAG No data
Right 1049832834 8:144713257-144713279 GCAGTGCTCCTTTCGGCTCCAGG 0: 1
1: 0
2: 2
3: 13
4: 145
1049832826_1049832834 7 Left 1049832826 8:144713227-144713249 CCAACAGGTTTCCGCCCGGGGTC No data
Right 1049832834 8:144713257-144713279 GCAGTGCTCCTTTCGGCTCCAGG 0: 1
1: 0
2: 2
3: 13
4: 145
1049832825_1049832834 8 Left 1049832825 8:144713226-144713248 CCCAACAGGTTTCCGCCCGGGGT No data
Right 1049832834 8:144713257-144713279 GCAGTGCTCCTTTCGGCTCCAGG 0: 1
1: 0
2: 2
3: 13
4: 145
1049832829_1049832834 -7 Left 1049832829 8:144713241-144713263 CCCGGGGTCACCGGCCGCAGTGC No data
Right 1049832834 8:144713257-144713279 GCAGTGCTCCTTTCGGCTCCAGG 0: 1
1: 0
2: 2
3: 13
4: 145
1049832830_1049832834 -8 Left 1049832830 8:144713242-144713264 CCGGGGTCACCGGCCGCAGTGCT No data
Right 1049832834 8:144713257-144713279 GCAGTGCTCCTTTCGGCTCCAGG 0: 1
1: 0
2: 2
3: 13
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049832834 Original CRISPR GCAGTGCTCCTTTCGGCTCC AGG Intergenic