ID: 1049832835

View in Genome Browser
Species Human (GRCh38)
Location 8:144713258-144713280
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049832828_1049832835 -3 Left 1049832828 8:144713238-144713260 CCGCCCGGGGTCACCGGCCGCAG No data
Right 1049832835 8:144713258-144713280 CAGTGCTCCTTTCGGCTCCAGGG No data
1049832830_1049832835 -7 Left 1049832830 8:144713242-144713264 CCGGGGTCACCGGCCGCAGTGCT No data
Right 1049832835 8:144713258-144713280 CAGTGCTCCTTTCGGCTCCAGGG No data
1049832821_1049832835 19 Left 1049832821 8:144713216-144713238 CCGGTGCGCTCCCAACAGGTTTC No data
Right 1049832835 8:144713258-144713280 CAGTGCTCCTTTCGGCTCCAGGG No data
1049832829_1049832835 -6 Left 1049832829 8:144713241-144713263 CCCGGGGTCACCGGCCGCAGTGC No data
Right 1049832835 8:144713258-144713280 CAGTGCTCCTTTCGGCTCCAGGG No data
1049832826_1049832835 8 Left 1049832826 8:144713227-144713249 CCAACAGGTTTCCGCCCGGGGTC No data
Right 1049832835 8:144713258-144713280 CAGTGCTCCTTTCGGCTCCAGGG No data
1049832825_1049832835 9 Left 1049832825 8:144713226-144713248 CCCAACAGGTTTCCGCCCGGGGT No data
Right 1049832835 8:144713258-144713280 CAGTGCTCCTTTCGGCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049832835 Original CRISPR CAGTGCTCCTTTCGGCTCCA GGG Intergenic
No off target data available for this crispr