ID: 1049832836 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:144713265-144713287 |
| Sequence | CGCGCTTCCCTGGAGCCGAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1049832836_1049832848 | 30 | Left | 1049832836 | 8:144713265-144713287 | CCTTTCGGCTCCAGGGAAGCGCG | No data | ||
| Right | 1049832848 | 8:144713318-144713340 | CTCAGCACATCCCTGACCGTCGG | No data | ||||
| 1049832836_1049832839 | 1 | Left | 1049832836 | 8:144713265-144713287 | CCTTTCGGCTCCAGGGAAGCGCG | No data | ||
| Right | 1049832839 | 8:144713289-144713311 | ACTCGCCCCTGCTGCCCGCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1049832836 | Original CRISPR | CGCGCTTCCCTGGAGCCGAA AGG (reversed) | Intergenic | ||