ID: 1049832837

View in Genome Browser
Species Human (GRCh38)
Location 8:144713266-144713288
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049832830_1049832837 1 Left 1049832830 8:144713242-144713264 CCGGGGTCACCGGCCGCAGTGCT No data
Right 1049832837 8:144713266-144713288 CTTTCGGCTCCAGGGAAGCGCGG No data
1049832832_1049832837 -8 Left 1049832832 8:144713251-144713273 CCGGCCGCAGTGCTCCTTTCGGC No data
Right 1049832837 8:144713266-144713288 CTTTCGGCTCCAGGGAAGCGCGG No data
1049832826_1049832837 16 Left 1049832826 8:144713227-144713249 CCAACAGGTTTCCGCCCGGGGTC No data
Right 1049832837 8:144713266-144713288 CTTTCGGCTCCAGGGAAGCGCGG No data
1049832821_1049832837 27 Left 1049832821 8:144713216-144713238 CCGGTGCGCTCCCAACAGGTTTC No data
Right 1049832837 8:144713266-144713288 CTTTCGGCTCCAGGGAAGCGCGG No data
1049832825_1049832837 17 Left 1049832825 8:144713226-144713248 CCCAACAGGTTTCCGCCCGGGGT No data
Right 1049832837 8:144713266-144713288 CTTTCGGCTCCAGGGAAGCGCGG No data
1049832828_1049832837 5 Left 1049832828 8:144713238-144713260 CCGCCCGGGGTCACCGGCCGCAG No data
Right 1049832837 8:144713266-144713288 CTTTCGGCTCCAGGGAAGCGCGG No data
1049832829_1049832837 2 Left 1049832829 8:144713241-144713263 CCCGGGGTCACCGGCCGCAGTGC No data
Right 1049832837 8:144713266-144713288 CTTTCGGCTCCAGGGAAGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049832837 Original CRISPR CTTTCGGCTCCAGGGAAGCG CGG Intergenic
No off target data available for this crispr