ID: 1049832839

View in Genome Browser
Species Human (GRCh38)
Location 8:144713289-144713311
Sequence ACTCGCCCCTGCTGCCCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049832832_1049832839 15 Left 1049832832 8:144713251-144713273 CCGGCCGCAGTGCTCCTTTCGGC No data
Right 1049832839 8:144713289-144713311 ACTCGCCCCTGCTGCCCGCCCGG No data
1049832836_1049832839 1 Left 1049832836 8:144713265-144713287 CCTTTCGGCTCCAGGGAAGCGCG No data
Right 1049832839 8:144713289-144713311 ACTCGCCCCTGCTGCCCGCCCGG No data
1049832833_1049832839 11 Left 1049832833 8:144713255-144713277 CCGCAGTGCTCCTTTCGGCTCCA No data
Right 1049832839 8:144713289-144713311 ACTCGCCCCTGCTGCCCGCCCGG No data
1049832829_1049832839 25 Left 1049832829 8:144713241-144713263 CCCGGGGTCACCGGCCGCAGTGC No data
Right 1049832839 8:144713289-144713311 ACTCGCCCCTGCTGCCCGCCCGG No data
1049832838_1049832839 -9 Left 1049832838 8:144713275-144713297 CCAGGGAAGCGCGGACTCGCCCC No data
Right 1049832839 8:144713289-144713311 ACTCGCCCCTGCTGCCCGCCCGG No data
1049832828_1049832839 28 Left 1049832828 8:144713238-144713260 CCGCCCGGGGTCACCGGCCGCAG No data
Right 1049832839 8:144713289-144713311 ACTCGCCCCTGCTGCCCGCCCGG No data
1049832830_1049832839 24 Left 1049832830 8:144713242-144713264 CCGGGGTCACCGGCCGCAGTGCT No data
Right 1049832839 8:144713289-144713311 ACTCGCCCCTGCTGCCCGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049832839 Original CRISPR ACTCGCCCCTGCTGCCCGCC CGG Intergenic
No off target data available for this crispr