ID: 1049833660

View in Genome Browser
Species Human (GRCh38)
Location 8:144718805-144718827
Sequence CTTTGGAAGGGCAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049833653_1049833660 -8 Left 1049833653 8:144718790-144718812 CCTGTAAGACCTGCACTTTGGAA No data
Right 1049833660 8:144718805-144718827 CTTTGGAAGGGCAAGGTGGGTGG No data
1049833647_1049833660 29 Left 1049833647 8:144718753-144718775 CCTAAGAAAACAGTAAGGCCAGG No data
Right 1049833660 8:144718805-144718827 CTTTGGAAGGGCAAGGTGGGTGG No data
1049833650_1049833660 11 Left 1049833650 8:144718771-144718793 CCAGGCGCCGTGGCTCACGCCTG 0: 626
1: 36587
2: 89936
3: 141162
4: 149234
Right 1049833660 8:144718805-144718827 CTTTGGAAGGGCAAGGTGGGTGG No data
1049833646_1049833660 30 Left 1049833646 8:144718752-144718774 CCCTAAGAAAACAGTAAGGCCAG No data
Right 1049833660 8:144718805-144718827 CTTTGGAAGGGCAAGGTGGGTGG No data
1049833651_1049833660 4 Left 1049833651 8:144718778-144718800 CCGTGGCTCACGCCTGTAAGACC No data
Right 1049833660 8:144718805-144718827 CTTTGGAAGGGCAAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049833660 Original CRISPR CTTTGGAAGGGCAAGGTGGG TGG Intergenic
No off target data available for this crispr