ID: 1049834001

View in Genome Browser
Species Human (GRCh38)
Location 8:144721346-144721368
Sequence GTGAGCCCAGCTGGTGCTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049834001_1049834007 14 Left 1049834001 8:144721346-144721368 CCCAGAGCACCAGCTGGGCTCAC 0: 1
1: 0
2: 0
3: 26
4: 250
Right 1049834007 8:144721383-144721405 ATCCATTCGTCATGAGTATCCGG 0: 1
1: 0
2: 0
3: 5
4: 38
1049834001_1049834009 30 Left 1049834001 8:144721346-144721368 CCCAGAGCACCAGCTGGGCTCAC 0: 1
1: 0
2: 0
3: 26
4: 250
Right 1049834009 8:144721399-144721421 TATCCGGATACAGCACCACACGG 0: 1
1: 0
2: 0
3: 0
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049834001 Original CRISPR GTGAGCCCAGCTGGTGCTCT GGG (reversed) Exonic
900386535 1:2413319-2413341 CTGAGCCCCGCAGGTGCTCTGGG + Intronic
900507912 1:3038874-3038896 CTGGGACCAGCTGGTGCTTTTGG + Intergenic
900625852 1:3608206-3608228 GGGAGCCCAGCTCCTGCCCTGGG + Intronic
901193668 1:7427769-7427791 GCAATCCCAGCTGGTCCTCTGGG + Intronic
903259715 1:22124855-22124877 GTGAGGCCAGCTGGAGTCCTGGG + Intronic
903828990 1:26163772-26163794 GTGGGACCCGCTGGTACTCTGGG + Intergenic
903965427 1:27086030-27086052 GTGACCCCAGCTGGGGCTCAGGG + Intergenic
904921117 1:34009227-34009249 GTGGGGCCAGCTGGGGTTCTGGG - Intronic
906655949 1:47548402-47548424 GTGAGCTCAACTGATGGTCTGGG + Intergenic
906717758 1:47982922-47982944 GTGAGGCCTGCTGGTGGTCTTGG - Intronic
907914384 1:58855203-58855225 CTGAGCGCAGCTGAGGCTCTGGG + Intergenic
907954234 1:59213172-59213194 CTGAGCTCATCTGGGGCTCTAGG + Intergenic
908036429 1:60059349-60059371 CTGACCTCAGCTGCTGCTCTGGG + Intronic
909312831 1:74175186-74175208 GTGAGGCCAGCTGGTCTGCTGGG + Intronic
911088061 1:93996038-93996060 CAGAGCCCAGCTGGTTCACTGGG - Intronic
912380434 1:109245054-109245076 GGTAGCCCAGCTGGGTCTCTAGG + Intergenic
914983928 1:152440647-152440669 GGGATCCCAGCAGGTCCTCTGGG + Intergenic
916975853 1:170076934-170076956 GTGAACCCAGCTGGACTTCTGGG + Intronic
919657806 1:200214409-200214431 GTCCTCCCAGCTGGTCCTCTGGG - Intergenic
919784279 1:201249309-201249331 CTGAGCGCAGCTAGTGGTCTTGG + Intergenic
922608687 1:226908226-226908248 GGGAGCTCAGCAGGTGCTCCAGG - Intronic
922661356 1:227433152-227433174 GTGAGCCCAGCTCATTCTGTGGG - Intergenic
1063121454 10:3107723-3107745 ATGTGCTCAGCTGATGCTCTGGG - Intronic
1064374392 10:14782619-14782641 GTGAGCCGAGATCGTGCTATTGG + Intergenic
1064654822 10:17546540-17546562 GTGAGCCAAGATTGTGCTGTTGG + Intergenic
1064692676 10:17933908-17933930 GTGAGTACAGCTTTTGCTCTGGG - Intergenic
1067414348 10:46092230-46092252 CAGAACCCAGCTGCTGCTCTGGG + Intergenic
1067434411 10:46266776-46266798 CAGAGCCCAGCTGCTGCTCTGGG + Intergenic
1067542640 10:47166764-47166786 GTGAAGCCAGCTGGTCTTCTGGG + Intergenic
1067581538 10:47449651-47449673 TAGAGCCCAGCTGCTGGTCTGGG - Intergenic
1068923652 10:62512275-62512297 TTGAGTCAAGCTGGTCCTCTTGG - Intronic
1069603421 10:69724466-69724488 GTGAAGCCACCTCGTGCTCTTGG + Intergenic
1069739395 10:70677833-70677855 GTGAGCTCAGCTGGGTCACTGGG - Intronic
1069748290 10:70729959-70729981 GTGGGGACAGCTGGTGATCTTGG + Intronic
1069859649 10:71462380-71462402 GGGAGCCCTGCTGGAGCTGTGGG + Intronic
1070307627 10:75248984-75249006 CTGAGCCCTGTTGGTGCTCTGGG - Intergenic
1070688340 10:78506688-78506710 GAGAGCCCTGCAGGTGCTCTGGG - Intergenic
1070725143 10:78782609-78782631 CTGAGCTCAGCTGGTGCTGGAGG - Intergenic
1071446276 10:85751050-85751072 GTGGGCCCAGAGGGGGCTCTGGG + Intronic
1075220014 10:120576588-120576610 GTGACCCCAGCAGGAGCTTTGGG + Intronic
1075590652 10:123688698-123688720 TTGTGCCCAGCTGGGACTCTTGG + Exonic
1075812262 10:125232776-125232798 GTATGCCCAGCTGGGCCTCTGGG + Intergenic
1076378390 10:130008319-130008341 GTGAGCAAAACTGGTGCTCATGG - Intergenic
1076805474 10:132855993-132856015 CTGAGCCCTGCAGGAGCTCTTGG - Intronic
1077556849 11:3230172-3230194 GTGACCCCAGCTTCTCCTCTTGG + Intronic
1078403085 11:11044989-11045011 GTCATCTCAGCTGGTGCTCCTGG + Intergenic
1078515602 11:12019480-12019502 GTGTGCTCAGCTGGGGCTCATGG + Intergenic
1078526665 11:12106665-12106687 AAGAACCCAGCTGGTGCTCGCGG - Intronic
1079428840 11:20369206-20369228 CTTATCCCAGCTGGTGTTCTGGG + Intronic
1080247398 11:30195317-30195339 GGGAGCTCAGCTGGGGCTGTTGG - Intergenic
1084056159 11:66634875-66634897 GGGAGCACAGCTGGTGGTCAAGG + Intronic
1085200371 11:74698325-74698347 GTAATCCCAGCTTGTGCTTTGGG - Intronic
1085507427 11:77068244-77068266 GTGGGCCCAGCTGCTGCTGCAGG + Intronic
1087150862 11:94858461-94858483 GAATGCCCAGCTGTTGCTCTGGG + Intronic
1087744784 11:101930778-101930800 GTGAAGCCAGCTGGGCCTCTGGG - Intronic
1088237764 11:107743367-107743389 GTGAGGCCAGTTGGTGCTTTGGG + Intergenic
1089309660 11:117549228-117549250 ATGAGCCCACCTGCTGCTCCTGG - Intronic
1090785759 11:130045817-130045839 GTGAGCCAAGATGGTGCCATTGG - Intergenic
1092077674 12:5686712-5686734 GTCAGCGCAGCTGGTGTCCTTGG - Intronic
1093355140 12:18157832-18157854 GTGAGCACAACTAGTGCTGTGGG - Intronic
1093435428 12:19130059-19130081 GTGCAGCCAGGTGGTGCTCTTGG - Exonic
1099414433 12:82370018-82370040 GTGAAGCCAGCTGGGCCTCTGGG - Intronic
1100189230 12:92173016-92173038 GTGAGCCGAGATGGTGCCATTGG - Intergenic
1102809642 12:115813231-115813253 GGGAGCTCAGCTGGGGCTGTTGG - Intergenic
1102826750 12:115953213-115953235 GTGAGCCCTACGGGTCCTCTGGG - Intergenic
1103944741 12:124519785-124519807 GTGAGGCCAGCTGGTGAACCAGG - Intronic
1105725399 13:23158770-23158792 GTGAGCCCAGCTGGACTTCCTGG + Intergenic
1105952610 13:25244461-25244483 GTGAGGCCAGCTGGACTTCTGGG - Intergenic
1109554076 13:63947659-63947681 GTGATGCCAGCTGGAACTCTGGG - Intergenic
1110241214 13:73269131-73269153 CTGAACCCAGATGGTGCTCCTGG - Intergenic
1110257325 13:73446029-73446051 GTGAGGCCAGCTGGACTTCTTGG - Intergenic
1113451093 13:110410276-110410298 GTTAGCCCAGGTTGTTCTCTAGG + Intronic
1113816091 13:113172218-113172240 GTGGGCCAAGCGGGTGGTCTGGG - Exonic
1113885344 13:113655969-113655991 CTGAGCCCAGCTGGTGCTGAAGG - Intronic
1114634500 14:24179688-24179710 GTGAGAGCAGCTCGAGCTCTGGG - Exonic
1114674549 14:24431582-24431604 GTCAGCCCATCTGGTGCCCAGGG + Exonic
1118897739 14:69960259-69960281 GAGAGCCAAACTGTTGCTCTAGG - Intronic
1121260126 14:92559804-92559826 GTGAGCCTTGCTGGGGCCCTTGG + Intronic
1122514522 14:102297777-102297799 GTGCGGCCAGCTGGTGCTGCTGG + Intronic
1122663650 14:103314472-103314494 GAGAGCCCAGCTCTTGCTCTCGG + Intergenic
1123910865 15:24965479-24965501 GTGAGCCGAGATGGTGCCATTGG + Intronic
1124696254 15:31867113-31867135 GAGAGGCCAGCTTGTGCTCCAGG - Intronic
1125603975 15:40929786-40929808 GTCAGCTCAGCTGGTGCCCGGGG - Intronic
1125748539 15:42013332-42013354 GTGGGCAAAGCGGGTGCTCTTGG + Intronic
1129456341 15:75677796-75677818 GCGAGGACAGCTGGAGCTCTAGG + Exonic
1130547746 15:84869015-84869037 TTGAGCCCAGATGGGGCTCAGGG + Exonic
1131245647 15:90790119-90790141 GTGTGATCAGCTGGTGCTATTGG + Intronic
1132603232 16:783088-783110 GTGAGCTCAGCCTTTGCTCTAGG - Intronic
1133036500 16:3036715-3036737 GTGAGCCCAGCCGCTTCTCTGGG - Intronic
1134843200 16:17417935-17417957 GGGAGCTCAGCTGGAGCTGTTGG - Intronic
1135622801 16:23970345-23970367 CAGAGCCCAGGTGGTGCTCTGGG - Intronic
1137293255 16:47066515-47066537 GTGTGGCCTGCTGCTGCTCTGGG - Intergenic
1137398191 16:48131889-48131911 CTGAGCCAAGGTGGTGCTTTGGG - Intronic
1138124356 16:54426617-54426639 GTGAGTACAGCTGTTGCTGTGGG + Intergenic
1138660193 16:58512119-58512141 CTGGGCCCAGCTGGTGCTGTAGG + Exonic
1139489832 16:67280189-67280211 GTGGCCCCGGCTGGTGGTCTTGG - Exonic
1140556769 16:75930445-75930467 GTGAGCCCTTCTGGTTGTCTGGG - Intergenic
1141894417 16:86949536-86949558 GTGAGAACAGCTGGTACTCATGG - Intergenic
1142476693 17:193216-193238 TTGAGCCTGGCTGGAGCTCTTGG + Intergenic
1143376759 17:6471674-6471696 GGGACCTCAGCTGGTGCTTTTGG - Intronic
1144643431 17:16952369-16952391 GTGGGGCCAGAGGGTGCTCTAGG + Intronic
1145205304 17:20981679-20981701 GTGGGGCCAGAGGGTGCTCTGGG - Intergenic
1145258042 17:21338259-21338281 GTGAGCCCAGCATCTGCTCATGG + Intergenic
1145778422 17:27545589-27545611 GGGGGTCCAGCTGGTGTTCTTGG - Intronic
1145841738 17:28000722-28000744 GTCACCCCAGCTCCTGCTCTTGG - Intergenic
1145991736 17:29083143-29083165 CTGAGCCCAGCTGGGTCTCCAGG - Intronic
1146126003 17:30232301-30232323 ATGAGACCAGGTGGTGATCTGGG - Intronic
1146242671 17:31244541-31244563 CAGAGCTCAGCTGGTGCTCAAGG - Intronic
1146694023 17:34895537-34895559 GCGAGAGCAGCTGGTACTCTTGG - Intergenic
1146928850 17:36763882-36763904 GTGAACACAGCTCCTGCTCTTGG - Intergenic
1146979094 17:37142570-37142592 GTGATCCCATCTGGAGCTATGGG + Intronic
1150264535 17:63823820-63823842 GTGACCCCGGATGGTGCTCAAGG + Exonic
1151325382 17:73376782-73376804 GTTTTCCCAGCTGGTGCTCCTGG + Intronic
1151943060 17:77304888-77304910 GTGAGCTCAGCTGGGGCTGGAGG + Intronic
1152311950 17:79556886-79556908 CTGTGTCCAGCTGGTGCTCAGGG + Intergenic
1152391447 17:80006166-80006188 GAGAGCGCTCCTGGTGCTCTGGG - Intronic
1152532438 17:80926967-80926989 GTGAGCCCAGCAGGTGGGCCTGG - Intronic
1152831392 17:82499043-82499065 GTGAGCCGAGATGGTGCCATTGG + Intergenic
1152890588 17:82879527-82879549 GTGAGCCCTTCTGGTGCTGCTGG + Intronic
1153668484 18:7387652-7387674 GTGAGGCCAGCTGGACTTCTTGG + Intergenic
1153825629 18:8871588-8871610 GGGAGCCCAGCTGGGGCCATGGG - Intergenic
1156240262 18:35247045-35247067 GTTAGCCAAGGTGGTACTCTAGG + Exonic
1157296506 18:46448638-46448660 GAGATCCCAGCGGGAGCTCTTGG + Intronic
1159920260 18:74221318-74221340 GTGAGCCCAGGCAGTGCTATTGG - Intergenic
1160986928 19:1843347-1843369 GCGAGTCCAGCTGCGGCTCTGGG - Intronic
1161267458 19:3370939-3370961 GTGCGCCCAGCGTGTGCTCATGG - Intronic
1161773309 19:6243061-6243083 CTGAGTCCAGCTGCTGATCTTGG + Intronic
1161912166 19:7202553-7202575 GTGAGCCGAGATGGTGCCATTGG - Intronic
1162363513 19:10233578-10233600 GTGAGCCAACATGGTGCTATTGG + Intergenic
1162419524 19:10558141-10558163 GTGAGATCAGCTGGGGCACTGGG - Intronic
1162812061 19:13170183-13170205 GTGAGCCCATCCTCTGCTCTGGG + Intergenic
1163404849 19:17115850-17115872 GAGATTCCAGCTGGTGATCTGGG - Intronic
1163489720 19:17609963-17609985 GGGAGCCCAGCTATTGTTCTTGG + Exonic
1163603111 19:18260432-18260454 ATGAGCCATGCTGGGGCTCTAGG - Intronic
1164566755 19:29331222-29331244 GTGAGACCAGCTGGGGCTGGAGG - Intergenic
1164697146 19:30253735-30253757 CTGAGCCCGGCTGGAGCTGTCGG - Intronic
1164862923 19:31577452-31577474 ATGAGCCCAGCCAGTGTTCTTGG - Intergenic
1165091117 19:33388874-33388896 CTGAGGGCAGCGGGTGCTCTGGG + Intronic
1165144563 19:33723049-33723071 GTGAGCCAGGCTGGTGCCCTGGG - Intronic
1165424475 19:35738373-35738395 GTGAGCCCAACTGCTTCTCTCGG + Exonic
1168227233 19:55004515-55004537 GTTAGCCCAGATGGTGGGCTTGG + Intergenic
1168258353 19:55179397-55179419 AGGAGCCCGGCTGTTGCTCTGGG - Intronic
925153668 2:1634608-1634630 ATGTGTCCAGCTGGTGGTCTTGG - Intronic
925328032 2:3037805-3037827 GTCAGGACCGCTGGTGCTCTCGG + Intergenic
926826247 2:16907647-16907669 GTGAGCCAAGATGGTGCCATTGG + Intergenic
929905694 2:46044406-46044428 CTGAGCTCATCTGGTGCTTTGGG + Intronic
936287034 2:111188907-111188929 GGGATCTCAGCTGGTGCTGTTGG + Intergenic
936631402 2:114207026-114207048 GTGAACCCAGCTGGGCTTCTGGG + Intergenic
938573812 2:132585649-132585671 GGGAGGTCAGCTGGTGCTCGAGG + Intronic
938770847 2:134499504-134499526 GTCAGGCCAGCTGGCTCTCTGGG - Intronic
945379054 2:209117366-209117388 ATGAGCCCAGCTGGGGACCTGGG + Intergenic
948086785 2:235257026-235257048 GAGAGCCCAGCAGGGGCTGTGGG - Intergenic
948678288 2:239611921-239611943 GTGAGCCCAGGTGATGCTCCTGG + Intergenic
1169103844 20:2977218-2977240 GTGAGCCAAGATCGCGCTCTTGG + Intronic
1169484907 20:6021120-6021142 GTGAGCCGAGATGGTGCCATGGG - Intronic
1169740430 20:8887953-8887975 GGGAGCCTAGCTGGGGCTCTGGG + Intronic
1172195209 20:33086839-33086861 CTGTCCCCAGGTGGTGCTCTTGG + Intronic
1173656366 20:44702944-44702966 GTCAGCCCAGCTGCTGGGCTGGG - Intergenic
1173802810 20:45905222-45905244 GGGAACCCAGCTGCTGTTCTTGG + Intronic
1175127375 20:56762628-56762650 GTGAGTCCAGCCGGAGCTCCTGG + Intergenic
1176147785 20:63573126-63573148 GAGAGCCAAGCTGGTGTTCGAGG - Intronic
1176183776 20:63766970-63766992 CTGAGCCCACCTGCTGCTCTGGG + Intronic
1176244263 20:64089901-64089923 GTGAGCCCAGCTGGGGCGGAGGG + Intronic
1178179149 21:30139930-30139952 GTGAGCCCAGCTGATTATTTTGG + Intergenic
1178516015 21:33247783-33247805 CTGAGACCAGATGGTTCTCTTGG - Intronic
1178520264 21:33283559-33283581 TTGAGCTCTGCTGGTGGTCTTGG - Intronic
1178743564 21:35226191-35226213 TTGTCCCCAGCTGCTGCTCTGGG + Intronic
1179382090 21:40909106-40909128 GGGAGCCAAGCAGGTGCTCTGGG - Intergenic
1180191737 21:46168575-46168597 GTGAGCACAGCAGGTCCTCCAGG + Exonic
1180590729 22:16935076-16935098 GTGAGGGCAGCTGCTGCTCAGGG + Intergenic
1180922420 22:19527892-19527914 AGGACCCCAGCTGCTGCTCTCGG - Intergenic
1181630534 22:24148825-24148847 GTGAGCCCAGCGGAGGCTGTGGG + Intronic
1181747547 22:24966330-24966352 GGGAGCCCAGCGGGTGCATTGGG + Intronic
1182049064 22:27299420-27299442 TTGATCCCAGCTGGGTCTCTGGG - Intergenic
1183843236 22:40518001-40518023 ATAAACCCAGATGGTGCTCTGGG + Intronic
1183978764 22:41527819-41527841 CTGAACCCATCTGGGGCTCTGGG - Exonic
1184069969 22:42141511-42141533 GTGAGCCCAGCTGGGGCCCAAGG - Intergenic
1184102523 22:42348286-42348308 GTGAACCCAGGTGCAGCTCTGGG - Intergenic
1184293575 22:43510409-43510431 AGGACCCCAGCTGCTGCTCTTGG + Intergenic
1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG + Intronic
1184851907 22:47125824-47125846 CTGAGCCCAGCTGGGGCTCCTGG + Intronic
949664782 3:6324892-6324914 GGGAGACCTGCTGGTGCTGTCGG + Intergenic
950437607 3:12989934-12989956 GAGACCCCAGCTGCTGCTCAAGG + Intronic
950775413 3:15345723-15345745 GAGAGAGCAGCTGGTGCTCATGG + Intergenic
952116569 3:30188872-30188894 GTGAGAGCAGCTGGGGCTTTTGG - Intergenic
953171419 3:40511192-40511214 GTGTGCCCATCTGTTCCTCTGGG - Intronic
954801114 3:53187411-53187433 GTGAGGGCAGCGGGGGCTCTTGG + Intronic
956663961 3:71624746-71624768 GTGAGCCGAGATGGTGCCATTGG + Intergenic
957460770 3:80516761-80516783 GGGAGCCCAGGTGGTGTCCTGGG - Intergenic
958891991 3:99794283-99794305 GGGGGCCCAGGTGGTCCTCTTGG - Exonic
961211684 3:125130678-125130700 GTGAGTCCAGCTCATACTCTGGG + Intronic
961466393 3:127084513-127084535 GTGAGCACAGCTGGGGCCCTAGG + Intergenic
961685143 3:128624878-128624900 ATGAGCACAGCTGGTGCTTGAGG - Intronic
962266585 3:133948513-133948535 GTGAGCCCAGAGGGTGCTGCAGG - Intronic
963466160 3:145685317-145685339 GTCAGCCCAGCAGATGCCCTGGG - Intergenic
964144961 3:153448662-153448684 GCAAGCCCAGATGCTGCTCTGGG - Intergenic
964466342 3:156997413-156997435 CTGAGCCCAGCTGCTTCTTTTGG - Intronic
966197084 3:177324281-177324303 GTCGCCCAAGCTGGTGCTCTTGG - Intergenic
966290412 3:178349553-178349575 GTGAGGCCAGCTGGGCTTCTGGG - Intergenic
968214233 3:196874598-196874620 GTGTGCCCAGCTGGAACTCCAGG - Intronic
969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG + Intronic
977047663 4:92088189-92088211 GTTAGTCCAGGTGGTGCCCTGGG - Intergenic
980077636 4:128310313-128310335 CCGAGGCCAGCTGTTGCTCTTGG + Intergenic
981577852 4:146223465-146223487 GTGTGCCCAGCTTCTGCCCTTGG + Intergenic
982074533 4:151725280-151725302 GCCAGCCGAGCTGGGGCTCTAGG + Intronic
983641383 4:169946796-169946818 GAGAACCCAGCTGGGGCTGTTGG + Intergenic
983863978 4:172741239-172741261 GTGATGCCACCTGGTGCTTTGGG + Intronic
985283648 4:188312195-188312217 GTGAGGCCAGTTGGTCCTCCAGG + Intergenic
986345082 5:6827198-6827220 CTGAGCTCAGCTGCTGCTCTTGG + Intergenic
986495780 5:8340315-8340337 GTGTGGCCAGCTAGGGCTCTTGG - Intergenic
987383328 5:17306544-17306566 GGGGGCCCAGCTGGAGCTCGAGG + Intergenic
988605169 5:32673170-32673192 GTGAGGCCAGCTGGGCTTCTGGG - Intergenic
988916189 5:35895575-35895597 GTGAGCTCAGCTGGCCCACTTGG - Intergenic
989047143 5:37284200-37284222 GTGAGCCAAGATCATGCTCTGGG + Intergenic
994496350 5:100517894-100517916 GTGAGTCCTGCTGCTGCCCTGGG - Intergenic
994588974 5:101749859-101749881 CTGTGCTCAGCTGATGCTCTGGG - Intergenic
994703867 5:103174774-103174796 CTCAGCCCATCTGGTGCTGTGGG - Intronic
999401490 5:151267670-151267692 GTCAGCCCAGCAGATGCCCTGGG - Exonic
1000244766 5:159440331-159440353 GTGAGCCCAGGTAGGGATCTAGG - Intergenic
1000460087 5:161505182-161505204 GTGAGCCGAGATGGTGCCATTGG - Intronic
1003359206 6:5408241-5408263 CTGAGCCCAGCCTGTGCTCCTGG + Intronic
1004051385 6:12083523-12083545 GTGAGGACCGCTGCTGCTCTAGG + Intronic
1007091376 6:39186913-39186935 GAGAGCCCAGGTGGTGCTGGTGG + Intergenic
1007122679 6:39396413-39396435 CCGAGCCCAGCAGGTGCACTGGG + Intronic
1007157498 6:39759690-39759712 ATAAGCCCAGCTGTTTCTCTAGG + Intergenic
1008536446 6:52509627-52509649 GTGAGACCTGCTGGGGCCCTGGG + Intronic
1009435965 6:63618834-63618856 GTGAGCCGAGATTGTGCTCCTGG + Intergenic
1011728446 6:90234827-90234849 GTGAACCCAGATGGTGCTAGAGG + Intronic
1018899385 6:168043615-168043637 GAGAGACCACCTGGTACTCTTGG + Intronic
1019135993 6:169908001-169908023 GAGACCCCACCTGGTGCTCAGGG + Intergenic
1019496373 7:1342308-1342330 CTGAGCCTTGCTGCTGCTCTGGG + Intergenic
1021030427 7:15726283-15726305 TTCATCCCAGCCGGTGCTCTTGG + Intergenic
1021317677 7:19170205-19170227 TTGAGCCCAGCTGATGTTCCAGG + Intergenic
1024044104 7:45575620-45575642 GCGAGCCCAGCACGCGCTCTAGG - Intronic
1024251755 7:47510817-47510839 GTGAGCCGAGATCGTGCCCTGGG + Intronic
1026511759 7:71033299-71033321 GTGGCCGCAGCTGGTGCACTTGG - Intergenic
1026863312 7:73807901-73807923 GTGGGGGCAGCTGGTGCTCGTGG + Intronic
1027244707 7:76359121-76359143 GTGAGCCCAGCTGGGGAGCGGGG - Intergenic
1029539001 7:101172165-101172187 GTGACCACAGCTGGGGCTCCAGG + Exonic
1032012159 7:128353784-128353806 GTGAGCCCCTCAGTTGCTCTGGG + Intronic
1034438234 7:151073872-151073894 GTGCTCACAGCTGGTTCTCTGGG + Intronic
1035448488 7:158958899-158958921 TTAAGCCCACCTGATGCTCTCGG - Intergenic
1037572821 8:20173009-20173031 GTGGCACCAGCTGGAGCTCTGGG - Intronic
1039075393 8:33686354-33686376 GTGAGCCCAGCTGAATTTCTTGG - Intergenic
1039546270 8:38413556-38413578 GTGGGCCCAGCAGGGGCTGTGGG + Exonic
1039759706 8:40561532-40561554 GAGGTCCCAGCTGGTGCTCAGGG + Intronic
1040496388 8:47969312-47969334 GTGAGCCAAGATGGTGCCATTGG - Intronic
1041136471 8:54764325-54764347 GTGTTCTCAGCTGGTGCTGTTGG + Intergenic
1041184015 8:55279675-55279697 GTGAGCCAGTATGGTGCTCTGGG + Intronic
1045581827 8:103489926-103489948 GTGGGCTCAGGTGGTCCTCTTGG - Intergenic
1048839662 8:138553833-138553855 GTGAGCTGAGCAGGTGCTCTGGG + Intergenic
1049602563 8:143514699-143514721 GTGAGCCCAGCTCCTGGGCTGGG - Intronic
1049834001 8:144721346-144721368 GTGAGCCCAGCTGGTGCTCTGGG - Exonic
1051165409 9:14256993-14257015 GTGGGCCCTTCTTGTGCTCTAGG - Intronic
1052290077 9:26830192-26830214 GTGAAACCAGCTGGTTTTCTGGG + Intergenic
1055803015 9:80061126-80061148 CTGAAGCCAGCTGGTGCTCTTGG + Intergenic
1057529558 9:95832001-95832023 GTGAACCCAGCTTGGGCTGTGGG + Intergenic
1058881648 9:109290535-109290557 CTGATCCCAGGTGGAGCTCTGGG - Intronic
1058964256 9:110021979-110022001 GTGAGCCCTACTATTGCTCTTGG + Intronic
1059506568 9:114804566-114804588 CAGCGCCCAGTTGGTGCTCTGGG - Intronic
1060002171 9:119968779-119968801 GTGAGCCCCCCTGGTGAGCTGGG + Intergenic
1061082808 9:128382323-128382345 GTGAGCCCAGCTGGGGGTCAGGG + Intronic
1061514158 9:131078982-131079004 GTGAGCCTAGCTGATGCCCCAGG - Intronic
1061944199 9:133899462-133899484 GTGAGCTCAGATCGTGCTATAGG - Intronic
1061987436 9:134137626-134137648 GTGAGCCCAGATCGTGCACCTGG + Intronic
1062161229 9:135081209-135081231 ATGACCCCAGATGGTGCTCTAGG + Intronic
1062197283 9:135281373-135281395 GTGAGCCCAGCAGCTGCCCGAGG - Intergenic
1185823431 X:3226452-3226474 ATAAGCCCAGGTGGGGCTCTTGG - Intergenic
1187566020 X:20450360-20450382 GTGAGCTCAGCTAGGACTCTCGG + Intergenic
1187570213 X:20493221-20493243 GAGACACCAGCTGGTTCTCTGGG - Intergenic
1189203373 X:39216898-39216920 GTGAGCCAAGATGGTGCTACTGG + Intergenic
1189558507 X:42169151-42169173 GGGAGCTCAGCTGGGGCTGTTGG + Intergenic
1191963157 X:66726075-66726097 GTGAGCCTAGCTGGGGCAATGGG - Intergenic
1196711633 X:118769712-118769734 GTGAGCCCAGGGGATGCTCATGG - Intronic
1198493087 X:137163405-137163427 GGGAGCTCAGCTGGGGCTGTTGG - Intergenic
1200448649 Y:3297450-3297472 CAGAGCTCAGCTGGTGCTCATGG + Intergenic
1201162145 Y:11174362-11174384 GTGAGCCCAGATTGTGCCATTGG - Intergenic