ID: 1049834001

View in Genome Browser
Species Human (GRCh38)
Location 8:144721346-144721368
Sequence GTGAGCCCAGCTGGTGCTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049834001_1049834007 14 Left 1049834001 8:144721346-144721368 CCCAGAGCACCAGCTGGGCTCAC 0: 1
1: 0
2: 0
3: 26
4: 250
Right 1049834007 8:144721383-144721405 ATCCATTCGTCATGAGTATCCGG 0: 1
1: 0
2: 0
3: 5
4: 38
1049834001_1049834009 30 Left 1049834001 8:144721346-144721368 CCCAGAGCACCAGCTGGGCTCAC 0: 1
1: 0
2: 0
3: 26
4: 250
Right 1049834009 8:144721399-144721421 TATCCGGATACAGCACCACACGG 0: 1
1: 0
2: 0
3: 0
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049834001 Original CRISPR GTGAGCCCAGCTGGTGCTCT GGG (reversed) Exonic