ID: 1049834217

View in Genome Browser
Species Human (GRCh38)
Location 8:144723428-144723450
Sequence CAGGCATAATGTCCATAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049834217 Original CRISPR CAGGCATAATGTCCATAATG TGG Intronic
900755476 1:4431460-4431482 CAGATATAATGTCAATAATGTGG - Intergenic
903051997 1:20608244-20608266 CATGCCCAAGGTCCATAATGCGG - Intronic
903814862 1:26057540-26057562 CAGGCCTAATGCCCAGGATGAGG + Intronic
905158253 1:36007266-36007288 AAGGGATAAAGTCCAAAATGGGG - Intronic
910176861 1:84440238-84440260 GAGAGGTAATGTCCATAATGGGG - Intergenic
911769704 1:101724652-101724674 CTTCTATAATGTCCATAATGTGG + Intergenic
915038074 1:152945225-152945247 CAGGCACTATGTCCATGCTGGGG - Intergenic
919439254 1:197608295-197608317 AAGGCATAATGTCTACAGTGAGG + Intronic
921984421 1:221295914-221295936 TAAGCATAATTTCTATAATGTGG + Intergenic
1063757585 10:9032136-9032158 GAGGCATAATGTACAGCATGAGG + Intergenic
1065292062 10:24240634-24240656 CAGTCATCATGTCCATAAAATGG + Intronic
1067198430 10:44143895-44143917 CCTCCATAATGTACATAATGAGG - Intergenic
1068056362 10:52016562-52016584 CAGGCATAATGTGGTTATTGGGG + Intronic
1069977911 10:72230579-72230601 TAGTCATAATGTCCACATTGAGG + Intronic
1073554344 10:104434150-104434172 CATGGATAATGTCTATAAAGTGG + Intronic
1077679838 11:4228538-4228560 GAGTGATAATGTCCCTAATGGGG + Intergenic
1077681648 11:4247371-4247393 GAGTGACAATGTCCATAATGGGG - Intergenic
1077689252 11:4325113-4325135 GAGTGATAATGTCCCTAATGGGG + Intergenic
1080638044 11:34140488-34140510 CCGGGATCATGTCCATGATGAGG - Exonic
1081407439 11:42714405-42714427 CAGGCAAAATGTCCATCATGGGG + Intergenic
1087825752 11:102763119-102763141 CAAGCGTGATGGCCATAATGGGG - Intergenic
1088392623 11:109331608-109331630 CGGGTAGAATTTCCATAATGCGG + Intergenic
1089203049 11:116736654-116736676 CACGCATAATGTCTACACTGAGG + Intergenic
1090543285 11:127732693-127732715 CAGTCATAAAATCCAAAATGGGG - Intergenic
1093102471 12:15044629-15044651 CAGGCATAATGCCCAGATTGTGG + Intergenic
1098661674 12:73102111-73102133 CAGGCATAATTAACATAATCTGG - Intergenic
1104550343 12:129751054-129751076 CAGGAATTATGTCCACAATGAGG - Intronic
1107856486 13:44620478-44620500 CAGGCATAATATCCATTAGTGGG + Intergenic
1108051998 13:46454687-46454709 CAAGGATAATGTCCAAAATCTGG - Intergenic
1109539289 13:63751506-63751528 CAAGGATAATGTCCAAAATCTGG + Intergenic
1109544555 13:63828328-63828350 CAAGGATAATGTCCAAAATCTGG - Intergenic
1111041744 13:82757632-82757654 CAGGCATATTATCCATCATGAGG + Intergenic
1111585450 13:90277975-90277997 CAGGCTTAATTTCCATGATTTGG + Intergenic
1112367451 13:98767516-98767538 CATGCAAAATGTCCATAGTTGGG + Intergenic
1114875382 14:26710784-26710806 CAGGCATAATGACCTCAATTTGG + Intergenic
1116303775 14:43221600-43221622 GAGGCCTAATGTACAAAATGAGG - Intergenic
1117654623 14:57942148-57942170 CAAGGAAAATGTCAATAATGAGG - Intronic
1117961015 14:61161521-61161543 CAGGCATGATTTACATAATTTGG + Intergenic
1128435344 15:67642437-67642459 AAGGCAGAATGTACATATTGAGG + Intronic
1130285187 15:82548889-82548911 CTGGCAAAATGTCAATGATGAGG - Intronic
1134887503 16:17806681-17806703 CAGGCATCATGTCCAGAACCTGG + Intergenic
1138756523 16:59493003-59493025 GAGACATAGTGGCCATAATGGGG + Intergenic
1138929167 16:61631429-61631451 CATGCATATTATCCATAATAAGG - Intergenic
1139934285 16:70557047-70557069 AAGGCCTAATGTCCACAATGTGG - Intronic
1140597108 16:76429639-76429661 CAGGTATAATGTCCACATGGTGG + Intronic
1149341484 17:55690879-55690901 CAGGCATCATGTCCATATCCTGG - Intergenic
1151530354 17:74700349-74700371 CTGGAATAAGGTCCGTAATGTGG - Intronic
1154509784 18:15085437-15085459 CAGACAAAATATGCATAATGAGG - Intergenic
1160526030 18:79538022-79538044 CAGTCATAATAGCCAAAATGTGG - Intergenic
1162045263 19:7995410-7995432 CAGGCTTACTGTCCACAGTGTGG + Intronic
1168341189 19:55624166-55624188 CAGGGATAATTTGCATAATTTGG - Intronic
925338639 2:3117320-3117342 TAGGCAGAATCTTCATAATGTGG + Intergenic
925564271 2:5232843-5232865 AAGGCTTAATTTTCATAATGTGG + Intergenic
925718108 2:6803345-6803367 CAGGAATGATGACCATGATGAGG + Intergenic
927415043 2:22870619-22870641 CAGGCATAATGCCAAGAATGAGG - Intergenic
927744676 2:25606937-25606959 CAAGCATAATTTTAATAATGTGG + Intronic
932915060 2:75848356-75848378 AAGGAAAAATGTCCAGAATGAGG + Intergenic
935871948 2:107460602-107460624 CAAGTGTAATGGCCATAATGAGG - Intergenic
936788912 2:116126644-116126666 CAGGCACAATATCCATATGGCGG + Intergenic
940363586 2:152821305-152821327 CAGCCATATGGCCCATAATGAGG - Intergenic
942492308 2:176501711-176501733 CAGGAAAAATATCCATAAAGAGG + Intergenic
942824910 2:180163946-180163968 CAGGCATAATGACAGGAATGAGG - Intergenic
943009828 2:182433725-182433747 CAGGCAGAATGTGGATATTGTGG - Intronic
944976495 2:205059009-205059031 AAGGCAAAATCTTCATAATGTGG - Intronic
946174521 2:217914215-217914237 CAGGCACTATTTCCATAGTGTGG + Intronic
948749811 2:240125066-240125088 CAGGCAGAGTGTCCCTACTGTGG - Intergenic
1169650594 20:7862420-7862442 CAAGCATAATCTTCATCATGTGG - Intergenic
1170744916 20:19090785-19090807 CAGGGATATTGTACATAATGTGG - Intergenic
1172578924 20:36031381-36031403 CAGGCATCAGGTCCAGGATGAGG + Intergenic
1176690384 21:9901696-9901718 CAGGTATAATTTCAATTATGGGG - Intergenic
1176788283 21:13286346-13286368 CAGACAAAATATGCATAATGAGG + Intergenic
1177987432 21:27994546-27994568 CAGACAAAATATGCATAATGAGG + Intergenic
951292300 3:20887678-20887700 CAGGCATACTGAGAATAATGTGG - Intergenic
953045399 3:39290134-39290156 CAGGGAGCATGTCCTTAATGGGG + Intergenic
955503497 3:59607917-59607939 CAGGCTTCATGTGTATAATGTGG + Intergenic
956684098 3:71808372-71808394 CGGGCGTAATGTACATAATTTGG + Intergenic
958461132 3:94397312-94397334 CAGGTACAATGTCCATTATCTGG + Intergenic
958643099 3:96834268-96834290 AATGCATAGTGACCATAATGGGG + Intronic
960890402 3:122442097-122442119 CAGGCATAATGATTATAAAGTGG - Exonic
961787327 3:129355484-129355506 TAGGCAAAATGTCCAGAATAGGG + Intergenic
965165539 3:165191186-165191208 CAGTAATAATGGCAATAATGTGG + Intronic
976789539 4:88862528-88862550 CAGTTATTATGTCCATGATGTGG + Intronic
979095857 4:116550302-116550324 CACGCCTAATGTCCAGAAGGCGG + Intergenic
979671382 4:123363514-123363536 CAAGCATAATGTTTACAATGGGG - Intergenic
980191094 4:129526212-129526234 CAGGCATTAGGTCCATGATATGG + Intergenic
980353791 4:131719613-131719635 CAGGTATAATTTCAATTATGGGG - Intergenic
982448654 4:155525322-155525344 GAGACATAATGTCCATAAAAAGG - Intergenic
982470999 4:155790232-155790254 CATGCAAAATATCCATAATATGG + Intronic
983698836 4:170566536-170566558 CTGGCATCATGTCCAGAATATGG - Intergenic
991479871 5:67066615-67066637 CAGCCAAAATGTCCATTAGGGGG - Intronic
1000253334 5:159515388-159515410 CAGGCATTGTGCCCTTAATGTGG + Intergenic
1002006854 5:176241412-176241434 AAGGCATAATATCCATTAAGAGG - Intronic
1002219523 5:177669220-177669242 AAGGCATAATATCCATTAAGAGG + Intergenic
1003002133 6:2346167-2346189 CAACCAAAATGTCCATAATCAGG - Intergenic
1003167019 6:3688560-3688582 CAGGCACAATGTCCTTATTTGGG - Intergenic
1003620254 6:7693142-7693164 CAGGCATTATCTCCATCTTGTGG + Intergenic
1008107323 6:47453370-47453392 ATGGCATAATATCCAGAATGAGG - Intergenic
1008133106 6:47740466-47740488 CAGGAATAAAGTGAATAATGTGG + Intergenic
1010356144 6:74936130-74936152 CAGACATAATTTCCATTATATGG + Intergenic
1013734265 6:113207343-113207365 CAGGCAAAATGTCCAGGATGGGG - Intergenic
1014371343 6:120612495-120612517 CAGGCATTGTGTTCATATTGAGG - Intergenic
1018952467 6:168388098-168388120 CAGGCAGGATGTCCATACGGAGG + Intergenic
1019131526 6:169880605-169880627 CAGGCACAATGTCCAGAAGCAGG - Intergenic
1020433241 7:8134549-8134571 TAGTCATAATGTCCAGAGTGGGG - Intronic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1028082306 7:86593230-86593252 CAGACATCATGACCATCATGTGG - Intergenic
1030425494 7:109372067-109372089 AAGGCATAAAGTTCTTAATGTGG + Intergenic
1031524448 7:122807488-122807510 CAATCATAATGTCTACAATGAGG + Intronic
1031624262 7:123974228-123974250 CTGTCATTATGTCCATGATGAGG + Intergenic
1032647017 7:133835928-133835950 CAGGCACAAGGTCTATAATTGGG - Intronic
1034513211 7:151553087-151553109 CAGGCATAGTGGCCATAATTCGG + Intergenic
1036158694 8:6366354-6366376 CAGAGATAATGTCCATGGTGAGG + Intergenic
1038699425 8:29835983-29836005 CAGGTATAAAGTCCATAACCTGG + Intergenic
1044504839 8:93005668-93005690 AAGGCATAATATACAGAATGTGG + Intronic
1046096621 8:109570319-109570341 CCGGCAAAATGTGCACAATGAGG - Intergenic
1047801561 8:128315502-128315524 CAGGCCTACTGTCCCTAAGGCGG + Intergenic
1049834217 8:144723428-144723450 CAGGCATAATGTCCATAATGTGG + Intronic
1051656539 9:19387275-19387297 CTGGCATAATGACGATGATGAGG - Intergenic
1052758148 9:32563010-32563032 AAGGTATAATGCCAATAATGAGG + Intronic
1053627115 9:39886214-39886236 CAGGTATAATTTCAATTATGGGG - Intergenic
1053778877 9:41579812-41579834 CAGGTATAATTTCAATTATGGGG + Intergenic
1054166837 9:61790052-61790074 CAGGTATAATTTCAATTATGGGG + Intergenic
1054216772 9:62364489-62364511 CAGGTATAATTTCAATTATGGGG + Intergenic
1054670710 9:67790851-67790873 CAGGTATAATTTCAATTATGGGG - Intergenic
1055522888 9:77099812-77099834 TTGGCATACTGTCCATAATATGG + Intergenic
1186035953 X:5423961-5423983 CAGACATAATGTGGTTAATGTGG + Intergenic
1189157087 X:38769519-38769541 CAGGGATATTATCCACAATGAGG + Intergenic
1194912087 X:99657808-99657830 CAGGTTTAATGTCTAAAATGAGG + Intergenic
1196246058 X:113401957-113401979 CAGTCATATTGTCTATATTGGGG - Intergenic