ID: 1049835629

View in Genome Browser
Species Human (GRCh38)
Location 8:144733855-144733877
Sequence GCAACGGTGTTAGCTGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049835629_1049835637 27 Left 1049835629 8:144733855-144733877 CCTGGAACAGCTAACACCGTTGC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1049835637 8:144733905-144733927 TGAGATGCTTCAGCTGCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049835629 Original CRISPR GCAACGGTGTTAGCTGTTCC AGG (reversed) Intronic
901028829 1:6294326-6294348 GAAATGGTGTCAGCTGTCCCTGG - Intronic
906573263 1:46862703-46862725 GCACCAGTGTTGGCTGCTCCAGG - Intergenic
906598613 1:47104391-47104413 GCACCAGTGTTAGCTACTCCAGG + Intronic
917261601 1:173175342-173175364 GCCACTGTGTTAGGTGTTCTGGG - Intergenic
919012396 1:191982773-191982795 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
923972949 1:239226237-239226259 GCAATGGTGTTAGATGTGCTAGG + Intergenic
1065860129 10:29865481-29865503 GCAACTATCTTAGCTGTCCCAGG - Intergenic
1068657711 10:59591899-59591921 GCACAGGTGTTAGCGGGTCCAGG - Intergenic
1069799237 10:71072022-71072044 GAAACTGTGTGAGCTGATCCAGG + Intergenic
1072483535 10:95832128-95832150 GGAACGGTTTTATCTGTTCAAGG - Intronic
1078345247 11:10541894-10541916 GCAGCAGTGTCAGCTGTACCTGG - Intergenic
1082764409 11:57155875-57155897 GCAAGGCTATTGGCTGTTCCTGG + Intergenic
1083782591 11:64925899-64925921 GCAGCGGTGTGAGCTCTTGCTGG - Exonic
1087685867 11:101264514-101264536 GCTAGGTTGTTAGTTGTTCCCGG + Intergenic
1090225831 11:125071777-125071799 GCACCTGTGGTATCTGTTCCTGG + Intronic
1101016372 12:100505025-100505047 GCAAAGTTGTTTGCTGTTCCTGG - Intronic
1104859903 12:131918446-131918468 GCCACGGTGTCTGCTGGTCCTGG + Intronic
1114473919 14:22981417-22981439 GCAAAGCTGTTAGCTCGTCCTGG + Exonic
1121529172 14:94640640-94640662 GCAAGGGTCTGAGCTGGTCCTGG - Intergenic
1124336127 15:28858436-28858458 ACAACGGTGTTGGCTGGTCCTGG + Intergenic
1127410216 15:58697766-58697788 GCACTGGTGTTAGCAGGTCCAGG - Intronic
1129070593 15:72946878-72946900 GCATTGGTGTTAGCAGGTCCAGG - Intergenic
1130039810 15:80396999-80397021 GCAAACGTGTTAGCTTTTGCAGG + Intronic
1130398661 15:83529250-83529272 GCACCAGTGTTAGCAGATCCAGG + Intronic
1138651971 16:58465787-58465809 GGAAAGGTGGAAGCTGTTCCTGG + Intronic
1138925216 16:61581877-61581899 GCAGCGGTGCCACCTGTTCCCGG + Intergenic
1148196530 17:45717254-45717276 GTAACTGTGTTACCTGTTCCAGG - Intergenic
1153364922 18:4245098-4245120 GCTACGTTGTTAGCTGCTACTGG + Intronic
1154936857 18:21068434-21068456 GAAACTGTTTTGGCTGTTCCAGG + Intronic
1158433903 18:57419760-57419782 TTAACGATGTTAGCTCTTCCAGG - Intergenic
1158440485 18:57470641-57470663 GCAGTGGTGTTAGCTCTTCAAGG - Intronic
1166903594 19:46087064-46087086 GCATCAGTGTTAGCAGGTCCAGG + Intergenic
925245993 2:2383532-2383554 AAAACTGTGTTAGCTGTTCACGG + Intergenic
931551420 2:63450545-63450567 GCACTGGTGTTAGCAGTACCAGG - Intronic
935868978 2:107424604-107424626 ATAATGATGTTAGCTGTTCCAGG - Intergenic
936785849 2:116094001-116094023 GCACTGGTGTTAGCAGGTCCAGG + Intergenic
937748656 2:125447078-125447100 GCAACGGTGGTAGAGGTTCAGGG - Intergenic
941047338 2:160691268-160691290 GCAACGGTGTTAAATGCTGCGGG + Intergenic
942700825 2:178707901-178707923 GCAACAGTGTTACCTGTTAGAGG - Intronic
944048656 2:195440875-195440897 GCACTGGTGTTAGCAGGTCCAGG - Intergenic
944260114 2:197667875-197667897 GCACTGGTGTTAGCAGGTCCAGG + Intronic
947752323 2:232539567-232539589 ACAGCGTTGTCAGCTGTTCCAGG - Intergenic
1168924471 20:1567774-1567796 ACTAAGGTGTTAGCTGTTGCTGG + Intronic
1169187899 20:3634250-3634272 GCAACGGTGGGAGCTGATTCTGG + Intronic
951449538 3:22820761-22820783 AAAACCGTGTTGGCTGTTCCTGG - Intergenic
953243984 3:41174553-41174575 GCAAGGGTGACAGCTGTGCCTGG - Intergenic
954725107 3:52601693-52601715 GCACTGGTGTTAGCAGGTCCAGG + Intronic
961003878 3:123391662-123391684 GCAATGGGCTTAGCTTTTCCAGG + Intronic
972554983 4:40172590-40172612 GCAAGGGAGGCAGCTGTTCCAGG - Intergenic
980901100 4:138905946-138905968 GAACCGCTGTTAGTTGTTCCTGG + Intergenic
985876494 5:2602593-2602615 GCAGCTGTGCTAGCAGTTCCTGG - Intergenic
992378663 5:76215867-76215889 ACAAAGGTGTTCGCTGTTTCTGG + Intronic
992704954 5:79381054-79381076 GCACCAGTGTTAGCAGTTCCAGG - Intronic
992893936 5:81231173-81231195 GCAATGGACTGAGCTGTTCCAGG - Intergenic
995099349 5:108279251-108279273 GCAACTGTGTTAGTGATTCCAGG - Intronic
997782009 5:136668098-136668120 GCACTGGTGTTAGCAGGTCCAGG - Intergenic
1003435962 6:6088311-6088333 GCAAGGGAGTTTGCTGTTTCAGG + Intergenic
1005884977 6:30090755-30090777 GCAAAGCTGTTACCTGTGCCTGG + Intergenic
1013638887 6:112054022-112054044 GTGACTGTGTTACCTGTTCCTGG - Intergenic
1016425816 6:143934882-143934904 GCACTGGTGTTAGCAGGTCCAGG + Intronic
1024063718 7:45716591-45716613 GCAACAGGGTTGGCTGTGCCAGG - Exonic
1027425972 7:78061826-78061848 CCAACAGTGTTAGTTGTTACAGG + Intronic
1030868959 7:114732869-114732891 GCAACGGTGTTAGTAGGACCAGG + Intergenic
1032901923 7:136320354-136320376 GCACCAGTGTTAGCAGATCCAGG + Intergenic
1036826044 8:11977061-11977083 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
1041539543 8:58967462-58967484 GGAACAGTGTCAGCTGTTCCTGG - Intronic
1044741909 8:95336236-95336258 GCAAAGGTCTTAACTGTTGCAGG + Intergenic
1049018644 8:139939237-139939259 GCAGAGGTGTTATCTCTTCCAGG - Intronic
1049797522 8:144503487-144503509 GCCACGGTGTGAGCTGTCCCAGG + Intronic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1050607151 9:7314234-7314256 GCAATGGTGTTAGTGGGTCCAGG + Intergenic
1055662693 9:78520612-78520634 GCAACAGTGTTAGCAGGTTCAGG - Intergenic
1188916562 X:35918871-35918893 GGAACCTTGTTAACTGTTCCAGG - Intergenic
1192840558 X:74850421-74850443 GCAACAATGTTAGTTGGTCCTGG - Intronic
1193112524 X:77743818-77743840 GTAACTGTGTTGGCAGTTCCAGG - Intronic
1193427959 X:81363515-81363537 GCAAAGGTATTACCTCTTCCAGG + Intergenic
1197864987 X:131008123-131008145 GTAACGGTGTTTACTGTCCCTGG - Intergenic