ID: 1049835637

View in Genome Browser
Species Human (GRCh38)
Location 8:144733905-144733927
Sequence TGAGATGCTTCAGCTGCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049835628_1049835637 28 Left 1049835628 8:144733854-144733876 CCCTGGAACAGCTAACACCGTTG 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1049835637 8:144733905-144733927 TGAGATGCTTCAGCTGCGCCTGG No data
1049835634_1049835637 11 Left 1049835634 8:144733871-144733893 CCGTTGCTGGGAGGGAGCGCACC 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1049835637 8:144733905-144733927 TGAGATGCTTCAGCTGCGCCTGG No data
1049835635_1049835637 -10 Left 1049835635 8:144733892-144733914 CCCATGCTTAGCATGAGATGCTT 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1049835637 8:144733905-144733927 TGAGATGCTTCAGCTGCGCCTGG No data
1049835629_1049835637 27 Left 1049835629 8:144733855-144733877 CCTGGAACAGCTAACACCGTTGC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1049835637 8:144733905-144733927 TGAGATGCTTCAGCTGCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049835637 Original CRISPR TGAGATGCTTCAGCTGCGCC TGG Intronic
No off target data available for this crispr