ID: 1049836389

View in Genome Browser
Species Human (GRCh38)
Location 8:144738249-144738271
Sequence GAACCCCATGGGCAACCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049836389_1049836396 25 Left 1049836389 8:144738249-144738271 CCACCTGGTTGCCCATGGGGTTC 0: 1
1: 0
2: 1
3: 9
4: 122
Right 1049836396 8:144738297-144738319 GCTCAATATGCCCCGTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049836389 Original CRISPR GAACCCCATGGGCAACCAGG TGG (reversed) Intronic
900389107 1:2426462-2426484 GGACCCCATGGGGACTCAGGAGG - Intronic
900786220 1:4652597-4652619 GAACCCCTTGGGCAGCCTTGTGG - Intergenic
902820789 1:18942008-18942030 GAGCCGCCTGGGCAGCCAGGAGG - Intronic
904772633 1:32888859-32888881 GACCCCCTTGGGGACCCAGGTGG + Exonic
905184205 1:36184745-36184767 GACCAGCCTGGGCAACCAGGTGG + Intergenic
905974328 1:42164167-42164189 GAACCACATGGACACCCTGGAGG - Intronic
908210179 1:61892467-61892489 GTACCCCATGAGCAAACAAGTGG - Intronic
910146102 1:84081744-84081766 AAGCCCCATAGGCAACCTGGAGG - Intronic
911150731 1:94595023-94595045 GAGCCCCAGGGGCTACCTGGTGG + Intergenic
912776503 1:112509156-112509178 GAACACCATGGCCCCCCAGGGGG + Exonic
918130240 1:181621215-181621237 TTGCCCCATGGGCAATCAGGAGG + Intronic
921848135 1:219905649-219905671 GTACACCATGGGGAACCACGGGG - Intronic
922717837 1:227886402-227886424 GACCCCCATGGGGCTCCAGGTGG + Intergenic
1065332571 10:24617860-24617882 TAAACCCATGGGACACCAGGGGG + Intronic
1065926052 10:30434424-30434446 GAATCCCCGGGGCACCCAGGCGG - Intronic
1065929297 10:30464997-30465019 CTGCCCCATGGGCACCCAGGAGG + Intergenic
1067551643 10:47240552-47240574 GATCCCCTAGGGCAAGCAGGAGG + Intergenic
1074919692 10:117994454-117994476 GAACCCAATGGGCTACAATGTGG + Intergenic
1075809296 10:125213002-125213024 GAACCTCCTGGGGAACCAAGAGG - Intergenic
1076739682 10:132477134-132477156 GAACAACGTGGGCATCCAGGAGG - Intergenic
1076799454 10:132813824-132813846 GAACCCCAAGGGCATCTGGGGGG + Intronic
1078849802 11:15153345-15153367 GCTAGCCATGGGCAACCAGGAGG - Intronic
1081653228 11:44839590-44839612 GAACCCCTGGGGCAGACAGGGGG - Intronic
1084448447 11:69218017-69218039 GGACTCCATGGGCAAACAGATGG - Intergenic
1086108127 11:83169129-83169151 GGACCTCATGGTCAGCCAGGAGG + Exonic
1087032255 11:93717396-93717418 GCATACCATGGGCAACCACGAGG + Intronic
1087128871 11:94651949-94651971 GAAACCCAGGGGCAAACATGGGG + Intergenic
1091688720 12:2581596-2581618 GAACTCCTTGAGCAACCTGGTGG + Exonic
1092192028 12:6528251-6528273 GATCCCCAGTGGCAACCATGAGG - Exonic
1101600058 12:106201621-106201643 GAACCCCTGGGCCAACCAGGCGG + Intergenic
1104849956 12:131868131-131868153 GAACCCCATGGGCTGCCTCGAGG - Intergenic
1105770463 13:23606495-23606517 GAACAACATGGGCTTCCAGGTGG - Intronic
1107444047 13:40454053-40454075 GAACAGCCTGGGCAACCTGGTGG - Intergenic
1111461107 13:88543200-88543222 AGAGCCCATGGACAACCAGGAGG + Intergenic
1113697224 13:112354945-112354967 GACCCCCATGGCCAGACAGGTGG - Intergenic
1113908518 13:113831209-113831231 CAGCCCCATGGGCAACCTGAGGG - Intronic
1115706019 14:35998836-35998858 GGACCCCATGGAAATCCAGGTGG + Intergenic
1117222598 14:53620754-53620776 GAATCCCATGGGCAAGCTGCTGG + Intergenic
1117654494 14:57940679-57940701 GAGACACCTGGGCAACCAGGTGG - Intronic
1120684119 14:87517943-87517965 GAATCCCAAGGACAACCAGCTGG - Intergenic
1121323677 14:93007412-93007434 GGAGCCCATGGGCTGCCAGGAGG - Intronic
1122427874 14:101622333-101622355 CAACCCCAAAGCCAACCAGGAGG + Intergenic
1124831641 15:33154566-33154588 GATCACGATGGGGAACCAGGAGG - Exonic
1130969197 15:88718841-88718863 GAGCCCCCTGGGCACCCAAGGGG - Intergenic
1132086045 15:98908992-98909014 GTCCCCCATGTGAAACCAGGAGG - Intronic
1132535206 16:475653-475675 GAACCCCCAGGGCATCCAGCCGG + Intronic
1136460680 16:30408173-30408195 GATCCCCATGGACAACAAGGAGG + Exonic
1141782611 16:86173872-86173894 GAACTTCATGTGTAACCAGGAGG - Intergenic
1143150152 17:4802548-4802570 GATCCCCATGGAGAAGCAGGAGG + Intergenic
1145266832 17:21383608-21383630 GATCCCCAGGGCCAAACAGGTGG - Intronic
1145933763 17:28703382-28703404 GAAGCCCATGGGAAGGCAGGTGG - Exonic
1148442722 17:47720117-47720139 TAACCCCATGGGGAATCAGGAGG - Intergenic
1152161205 17:78669673-78669695 TAACCCCAGGAGCAAACAGGTGG - Intergenic
1153041508 18:816655-816677 GACTGCCATGGGCAAGCAGGAGG - Intergenic
1155403707 18:25465309-25465331 GACCCCCATGGGTACCCAGATGG - Intergenic
1157420866 18:47546596-47546618 GGAGCACATGGCCAACCAGGAGG + Intergenic
1157484389 18:48076636-48076658 GAACCCCATGGGCAGGGAGCAGG + Intronic
1158387340 18:57010107-57010129 GAACTCCATGTGGAAGCAGGAGG + Intronic
1159133688 18:64310524-64310546 GAACCCCATGAGCAAACACGTGG - Intergenic
1163790308 19:19302451-19302473 GAACCCCAAGGGCAACAAGTGGG + Intronic
1165169255 19:33879691-33879713 GAACCCCCAGGGGAAGCAGGGGG + Intergenic
1167490741 19:49791644-49791666 GTACCCCATGGGCACCCAGTAGG + Intronic
1167755550 19:51411125-51411147 GATGCCCAAGGGCACCCAGGCGG - Exonic
1168136636 19:54356288-54356310 GAACCTCAGGGGCAGCCTGGCGG + Intronic
925058459 2:873145-873167 GGAACCCATGGGCACCGAGGTGG + Intergenic
930847093 2:55917882-55917904 GAACCTCAGGGGCAACCACCGGG - Exonic
932121262 2:69102693-69102715 GAACACCAAAAGCAACCAGGTGG - Intronic
933584122 2:84161456-84161478 GATCTTCATGGGCAGCCAGGAGG + Intergenic
934980844 2:98838746-98838768 CAACCTCATGGGCAAGAAGGTGG + Intronic
938804015 2:134789363-134789385 AAACCCAATGGGAAGCCAGGTGG + Intergenic
939592641 2:144084205-144084227 TCAGCCCATGGGCAACCAGCTGG + Intronic
941145125 2:161834886-161834908 GAACCCCAAGGCCAACTAGCTGG + Intronic
948747393 2:240106601-240106623 GAGCCTCATAGGCAAGCAGGAGG + Intergenic
1176002065 20:62836657-62836679 GACCCCCAAGGGCTAACAGGCGG - Intronic
1176040046 20:63060549-63060571 GAGCCCCAGGGCCAGCCAGGAGG - Intergenic
1176144734 20:63560493-63560515 GAACTCCAAGGCCAACCTGGAGG - Exonic
1177198137 21:17924293-17924315 GAAGCCCAAGGGCCAGCAGGAGG + Intronic
1178133054 21:29595117-29595139 GAACATGATGGGCTACCAGGAGG + Intronic
1180088240 21:45517739-45517761 CAACCCCAGGGGCATCAAGGGGG + Intronic
1180785973 22:18548075-18548097 GAACCACATCGGCATGCAGGAGG + Intergenic
1181131256 22:20733800-20733822 GAACCACATCGGCATGCAGGAGG + Exonic
1181242896 22:21487629-21487651 GAACCACATCGGCATGCAGGAGG + Intergenic
1181474741 22:23161224-23161246 GGACCTCATGGGCATCCATGAGG + Intronic
1184474778 22:44714523-44714545 GGGCCTGATGGGCAACCAGGGGG + Intronic
953871913 3:46634239-46634261 GAAACTCATGGGAAACCAAGGGG - Intergenic
954716143 3:52527866-52527888 GTTTCCCATGGGCCACCAGGCGG + Exonic
956747867 3:72323736-72323758 GCAGCCCATGGGCAATCAGCTGG - Intergenic
966569100 3:181420840-181420862 GAACCCCATGAGAGACCATGTGG - Intergenic
969313464 4:6367757-6367779 GCACCCCATGGGGAGCCAAGCGG + Intronic
970876527 4:20877091-20877113 AAACCCAATGGGAAACCAGAAGG - Intronic
973544070 4:51962715-51962737 GAACTCCATGGGCATGCAGGAGG - Intergenic
974070732 4:57121213-57121235 GAACCCCATGGGCACACAGGAGG - Intergenic
982113902 4:152081332-152081354 GAAAGCCATGGTCAACTAGGAGG + Intergenic
985539913 5:483074-483096 GAACCCCAAGGGAAACCACTTGG - Intronic
994058267 5:95444999-95445021 GTCCCCCAGGGGCAAGCAGGTGG + Intronic
994177559 5:96728284-96728306 CATCCCCAGGGGCCACCAGGAGG - Intronic
997615725 5:135244942-135244964 GACCCTGATGGGCAAACAGGTGG + Intronic
1001917305 5:175572313-175572335 GAACCTCATGGGAAACAAGAGGG - Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1006267633 6:32938514-32938536 GAACCTCAAGGGGAACAAGGTGG - Intronic
1006280755 6:33051229-33051251 AAACCCCATAAGTAACCAGGTGG + Intergenic
1007107734 6:39295228-39295250 CAAACCCATGGGGAAGCAGGGGG + Intergenic
1007662518 6:43495518-43495540 GAACACCATGGGCCCCCTGGTGG + Intronic
1012681744 6:102191478-102191500 TATACCCATGTGCAACCAGGAGG - Intergenic
1013431024 6:110054901-110054923 GAACCCCAGGGGCCATCAGCTGG + Intergenic
1014913707 6:127120483-127120505 GATCCCCTTGGGAAACCAGGTGG - Intronic
1016466130 6:144327402-144327424 GAACCTCAAGGGCAGCCAGCAGG - Intronic
1016699772 6:147040972-147040994 GAACATCAAGGGCAAACAGGAGG - Intergenic
1025021163 7:55481257-55481279 GAGCCCGCTGGGCAGCCAGGAGG + Intronic
1030246255 7:107387162-107387184 GAGCCCCATGGTCAAGCAGATGG + Intronic
1031156324 7:118116083-118116105 CAACCCCATAAGTAACCAGGCGG + Intergenic
1031597252 7:123662507-123662529 GCACATCATGGGCAGCCAGGTGG + Exonic
1032489435 7:132313074-132313096 CACCCCCATGTGCATCCAGGGGG - Intronic
1035916547 8:3630835-3630857 GATCCCCACAGGCAACCAAGAGG + Intronic
1039538856 8:38344867-38344889 GACCCCTATGGACAACCAGTAGG + Intronic
1041296467 8:56362346-56362368 GAAACCCATGGGTATCCAAGTGG + Intergenic
1043984033 8:86672609-86672631 GAACCCCATGGGCTGCCACTTGG - Intronic
1049836389 8:144738249-144738271 GAACCCCATGGGCAACCAGGTGG - Intronic
1049939654 9:533203-533225 GAACCCCAAGGGCAATTTGGAGG + Intronic
1051246607 9:15118076-15118098 GATACCCATGGGCACCCAGTGGG - Intergenic
1056404928 9:86264311-86264333 GACCCTCATGGGGAACAAGGAGG + Intergenic
1056557641 9:87703154-87703176 GAACCCCCTGGCCAGCGAGGAGG + Exonic
1056560198 9:87723225-87723247 GAACCCCATTCGCCACCAGGAGG - Intergenic
1056620188 9:88206101-88206123 GAACGCCATGGACCTCCAGGAGG + Intergenic
1060600622 9:124875183-124875205 GAACCCCAAGGCAAGCCAGGTGG - Intronic
1186699652 X:12076620-12076642 GATCTCTATGGGCTACCAGGGGG - Intergenic
1189215643 X:39320789-39320811 GAACCCTCTGAGAAACCAGGTGG + Intergenic
1191712123 X:64161081-64161103 ACACACCATGGGGAACCAGGGGG + Intergenic
1194159939 X:90437457-90437479 GAACCCCAAGGATAAACAGGGGG - Intergenic
1195161916 X:102179637-102179659 CAACCCCATAAGTAACCAGGTGG - Intergenic
1197165119 X:123368554-123368576 GAAGGCAATGGGGAACCAGGAGG + Intronic
1200328398 X:155266519-155266541 GAACCCCATAGGCTGCCAGTGGG - Intergenic
1200506232 Y:4014410-4014432 GAACCCCAAGGATAAACAGGGGG - Intergenic