ID: 1049840366

View in Genome Browser
Species Human (GRCh38)
Location 8:144767128-144767150
Sequence GAATTCCACTCATGCTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049840359_1049840366 12 Left 1049840359 8:144767093-144767115 CCTCTCTCCAAGTTCCCTATAGA No data
Right 1049840366 8:144767128-144767150 GAATTCCACTCATGCTTGGCAGG No data
1049840363_1049840366 -3 Left 1049840363 8:144767108-144767130 CCTATAGATGTTGCACCATGGAA No data
Right 1049840366 8:144767128-144767150 GAATTCCACTCATGCTTGGCAGG No data
1049840357_1049840366 14 Left 1049840357 8:144767091-144767113 CCCCTCTCTCCAAGTTCCCTATA No data
Right 1049840366 8:144767128-144767150 GAATTCCACTCATGCTTGGCAGG No data
1049840358_1049840366 13 Left 1049840358 8:144767092-144767114 CCCTCTCTCCAAGTTCCCTATAG No data
Right 1049840366 8:144767128-144767150 GAATTCCACTCATGCTTGGCAGG No data
1049840356_1049840366 24 Left 1049840356 8:144767081-144767103 CCTGAGGTAGCCCCTCTCTCCAA No data
Right 1049840366 8:144767128-144767150 GAATTCCACTCATGCTTGGCAGG No data
1049840360_1049840366 5 Left 1049840360 8:144767100-144767122 CCAAGTTCCCTATAGATGTTGCA No data
Right 1049840366 8:144767128-144767150 GAATTCCACTCATGCTTGGCAGG No data
1049840362_1049840366 -2 Left 1049840362 8:144767107-144767129 CCCTATAGATGTTGCACCATGGA No data
Right 1049840366 8:144767128-144767150 GAATTCCACTCATGCTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049840366 Original CRISPR GAATTCCACTCATGCTTGGC AGG Intergenic
No off target data available for this crispr