ID: 1049844158

View in Genome Browser
Species Human (GRCh38)
Location 8:144792092-144792114
Sequence CGTGGACAGAGGAAGGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 228}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049844158_1049844168 7 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844168 8:144792122-144792144 CGGCCCATGGCGACGGGTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 79
1049844158_1049844164 -6 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844164 8:144792109-144792131 TCCACGGATCACACGGCCCATGG 0: 1
1: 0
2: 1
3: 1
4: 54
1049844158_1049844170 9 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 94
1049844158_1049844166 0 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844166 8:144792115-144792137 GATCACACGGCCCATGGCGACGG 0: 1
1: 0
2: 0
3: 2
4: 53
1049844158_1049844175 29 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844175 8:144792144-144792166 GGGGCGACTCACGATTAGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 11
1049844158_1049844167 1 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844167 8:144792116-144792138 ATCACACGGCCCATGGCGACGGG 0: 1
1: 0
2: 0
3: 1
4: 48
1049844158_1049844172 10 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844172 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 2
3: 9
4: 86
1049844158_1049844169 8 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844169 8:144792123-144792145 GGCCCATGGCGACGGGTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049844158 Original CRISPR CGTGGACAGAGGAAGGGCGC CGG (reversed) Exonic
900638286 1:3676196-3676218 CGGGGACAGAGGATGGGAGAAGG + Intronic
901797984 1:11691636-11691658 AGGGGACAGAGGAGGGGCGGCGG - Exonic
902289854 1:15428896-15428918 CGTGCAGAGTGGAAGGGAGCGGG - Exonic
903325842 1:22568076-22568098 CATGGAGAGAGGCAGGGGGCGGG + Intronic
903648037 1:24906403-24906425 GGTGGACAGAGGCAGGCAGCTGG - Intronic
904868002 1:33597229-33597251 AGTGGACAGTGGAAGGGAGTGGG - Intronic
905734791 1:40317428-40317450 CGAGGACAGAGGGTGGGCGCAGG - Intronic
906636906 1:47416146-47416168 CGTGAACAGAGTAAGGGGGCTGG + Exonic
908083787 1:60608860-60608882 TGTGGACAGAGTAAGGGGGCAGG - Intergenic
913380985 1:118209867-118209889 CCTGGGCAGAGGAGAGGCGCTGG + Intergenic
917749411 1:178040715-178040737 CGAGGACAGGGGAAGGGGACTGG - Intergenic
917843670 1:179002893-179002915 CGGGGAGAGAGGAAAGGCCCCGG + Intergenic
918820612 1:189249962-189249984 GGTGGAAAGAGGAAGGTCCCTGG + Intergenic
920071356 1:203305419-203305441 CGCGGCCAGAGGATGGGGGCGGG - Intergenic
923494708 1:234513979-234514001 CGGGGGCAGAGGAGGGGCGATGG + Intergenic
923604044 1:235427311-235427333 TGTGGAAAGAGGTAGGGAGCCGG + Intronic
1066203511 10:33164580-33164602 CGGGGACCGAGGAATGGCTCTGG + Intergenic
1066602764 10:37125686-37125708 CGTGGACTGAAGAAGGGCGAGGG + Intergenic
1067222323 10:44353079-44353101 CGGGGACAGAGGCAGGGCTGGGG + Intergenic
1067534429 10:47098722-47098744 CGTGGTCAGAGGCAGGGAGAGGG + Intergenic
1069095779 10:64258224-64258246 CATGGACACAGGAAGGGGGGTGG + Intergenic
1069889759 10:71645525-71645547 CTGGGACAGAGAAAGGGAGCAGG + Intronic
1069962741 10:72087961-72087983 CAGGGACAGGGGAGGGGCGCTGG + Intronic
1071256791 10:83878608-83878630 GGGGGCCAGAGGAAGGGCACTGG - Intergenic
1076721926 10:132396746-132396768 CGGGGAGGGAGGGAGGGCGCAGG + Intergenic
1077046818 11:550337-550359 CCTGGCCAGAGGAGGGGCCCCGG - Intronic
1077107394 11:848134-848156 CGTGGCCAGGGGAAGGGGGCCGG + Intronic
1077123919 11:924247-924269 CGTGGGCAGAGCATGGGCTCTGG - Intergenic
1077443107 11:2577871-2577893 CGTGGACAGAGGGAGGCCCCTGG - Intronic
1078315205 11:10288960-10288982 CGTGGATGGCGGAAGGGGGCAGG - Intronic
1079444654 11:20547757-20547779 CGTGGAGAGAGGGAGGGAGAGGG - Intergenic
1079486623 11:20941801-20941823 CGTGGATAGAGGAAGGGGAAGGG + Intronic
1081486936 11:43538034-43538056 CGAGGAGAGAGGCAGAGCGCAGG - Intergenic
1083476169 11:62917045-62917067 CTTGGACAGAGAAAGAGCTCAGG + Intronic
1083593949 11:63910205-63910227 CATGGGGAGAGGAAGGGCGAGGG - Exonic
1084086924 11:66859127-66859149 AGAGGGCGGAGGAAGGGCGCCGG - Intronic
1084106530 11:66984297-66984319 CCTGGTGAGAGGAAGGGCCCAGG + Intergenic
1084310530 11:68313506-68313528 CGTGGGGAGAGGTAGGGCGGGGG + Intronic
1084520129 11:69657744-69657766 AGGGGACAGAGGAAGGAGGCTGG + Intronic
1085522222 11:77145558-77145580 CTGGGACAGAGGCAGGGAGCGGG + Intronic
1087174042 11:95079970-95079992 CATGGACAGAGGAAGGGAGAGGG - Intergenic
1089128474 11:116193784-116193806 AGAGGACCGAGGAAGGGGGCAGG - Intergenic
1089738175 11:120564095-120564117 GGTGGCCTGAGGAAGGGCCCGGG + Intronic
1090234835 11:125139617-125139639 CCCGGACAGAGGAAGGGAGATGG - Intergenic
1091792363 12:3279145-3279167 CCTGGCCAGAGGAAGAGTGCTGG + Intronic
1091909236 12:4215393-4215415 CTTTGACAGAGGTAGGGAGCTGG + Intergenic
1092247788 12:6873116-6873138 CGAGGGCAGATGAAGGGCCCAGG - Intronic
1093131368 12:15395300-15395322 CTTGGAAAGAGGAAGGGTGAGGG + Intronic
1099439501 12:82684252-82684274 CAAGGAGAGAGGAAGGGAGCAGG - Intergenic
1099905807 12:88768474-88768496 AGTGGACTGAGGAAGGCCTCTGG - Intergenic
1103403832 12:120660947-120660969 CTTGGACAGAGAAAGGTCTCTGG + Intronic
1104767834 12:131341798-131341820 TGTGGACAGAGTGAGGGAGCAGG - Intergenic
1104811886 12:131624284-131624306 TGTGGACAGAGCGAGGGAGCAGG + Intergenic
1109036469 13:57268190-57268212 TGTGGACAGAGGAGGGAAGCGGG - Intergenic
1113720871 13:112555246-112555268 TGTGGACAGAGGCTGGACGCGGG + Intronic
1113759291 13:112836468-112836490 GATGGACAGAGCAAGGGTGCCGG - Intronic
1113868273 13:113543192-113543214 CACGGACAGAGGGAGGGCGAGGG - Intronic
1113868349 13:113543389-113543411 CATGGACAGAGGGAGGGCAGGGG - Intronic
1117799454 14:59428127-59428149 CGTGGACAGAATGAAGGCGCAGG + Intergenic
1118854654 14:69611676-69611698 TGTGGGCAGAGGAAGCGGGCGGG - Exonic
1119310855 14:73645131-73645153 CTTGAACAGCGGAAGGGAGCCGG + Intronic
1119420417 14:74504900-74504922 AGGGGAGAGAGGAAGGGGGCAGG - Intronic
1120765234 14:88322700-88322722 CGGAGACAGAGGCAGGGCGAGGG + Intronic
1123005833 14:105323370-105323392 CGTGGACAGAGGCAGGGGGAAGG - Intronic
1124636164 15:31366321-31366343 CTTGGTGAGAGGAAGGGGGCTGG - Intronic
1125672571 15:41484690-41484712 AGTGGAGAGAAGAAGGGTGCTGG + Intergenic
1127328345 15:57916495-57916517 CGAGAACAGAGGGAGGGCACCGG + Intergenic
1127715392 15:61644599-61644621 CGGGGACAGAGGCAGGAGGCTGG - Intergenic
1128154295 15:65383119-65383141 CGCGGATACAGGAAGGGCACGGG + Exonic
1128155056 15:65386687-65386709 TCAGGACAGAGGAAGGGCACAGG + Intronic
1128594476 15:68930976-68930998 GGTGGGCAGAGGAAGGCCTCCGG - Intronic
1129295032 15:74595564-74595586 TGTGGGCAGAGGAAGAGCGAAGG - Intronic
1129350896 15:74955557-74955579 CGTTGACAGAGGAAGGCAGGGGG - Exonic
1130209372 15:81909360-81909382 GCAGGACAGAGGCAGGGCGCGGG - Intergenic
1131053607 15:89363022-89363044 AGCGGAAAGGGGAAGGGCGCAGG + Intergenic
1131169535 15:90167629-90167651 CCTGGACACAGGAAGAGAGCTGG + Intronic
1132634346 16:936141-936163 CGTGGGCTGAGGAAGGTGGCTGG + Intronic
1132634372 16:936221-936243 CGTGGGCTGAGGAAGGAGGCTGG + Intronic
1132634386 16:936262-936284 CGTGGGCTGAGGAAGGAGGCTGG + Intronic
1132634400 16:936303-936325 CGTGGGCTGAGGAAGGTGGCTGG + Intronic
1132634438 16:936424-936446 CGTGGGCTGAGGAAGGAGGCTGG + Intronic
1132634454 16:936465-936487 CGTGGGCTGAGGAAGGTGGCTGG + Intronic
1132634492 16:936586-936608 CGTGGGCTGAGGAAGGAGGCTGG + Intronic
1133573538 16:7065408-7065430 TGTGGACAGAGGAACGAGGCAGG - Intronic
1135281754 16:21158812-21158834 CGGGGACAGAGGAGGAGCGCGGG + Intronic
1135335664 16:21599438-21599460 ATTGGACGGAGGGAGGGCGCCGG + Intronic
1136402437 16:30025878-30025900 AGGGGAAAGAGGAAGGGCGGGGG - Intronic
1137716865 16:50603473-50603495 CGGGGAAAGAGGAGGGGGGCAGG - Intronic
1139560946 16:67741782-67741804 TGTTGACAGAGGAAAGGAGCAGG + Intronic
1139864015 16:70050323-70050345 CGTGGAGAGAGGGAGGGGGAGGG - Intergenic
1140507447 16:75482735-75482757 TGTGGACAGGGGAAGGGGGCAGG - Intronic
1140514524 16:75532461-75532483 TGTGGACAGGGGAAGGGGGCAGG - Intronic
1141828681 16:86497750-86497772 CGGGGACGGGGGAAGGGGGCGGG + Intergenic
1142134315 16:88444626-88444648 CGTGGACAGAGGACACGGGCAGG - Intergenic
1142855045 17:2724529-2724551 CGTGCATAGAGGAAGAGCGCGGG + Intergenic
1143460251 17:7099191-7099213 CATGTACACAGGAAGGGCTCTGG + Intergenic
1143599401 17:7934282-7934304 AGTGGACAGAGGAAGCAGGCAGG + Intronic
1143651064 17:8264608-8264630 AGGGGGCAGAGGAAGGGTGCAGG - Intronic
1144181017 17:12752737-12752759 CGTGGACTGGGGACGGGTGCAGG - Exonic
1144944743 17:18964124-18964146 GGTAGAGAGAGGAAGGGGGCTGG - Intronic
1146968585 17:37054120-37054142 CCTGGAAAGAGGAAGGGCTGAGG + Intronic
1147770455 17:42864446-42864468 CGGGGACAGAGGAGGGGCCTAGG + Intergenic
1147791053 17:43014502-43014524 CATGGAAAGAGGCAGGGGGCAGG + Intergenic
1148059970 17:44829842-44829864 CGGGGACAGTGGCAGGACGCGGG + Intronic
1148901894 17:50884781-50884803 GGTGGAAAGAGGAAGGGGGTGGG - Intergenic
1150548889 17:66191517-66191539 CGGGGACAGAACCAGGGCGCTGG - Intronic
1150894795 17:69197000-69197022 CGTGGACAGAGGGAGGGGGAGGG + Intronic
1152036243 17:77874889-77874911 AGCGGAGAGAGGAAGGGTGCAGG + Intergenic
1152430401 17:80245693-80245715 CGTGGAGATAGGAAGGGCCTCGG + Intronic
1156483420 18:37450091-37450113 CGTGGGGAGGGGAAGGGAGCAGG + Intronic
1157502789 18:48202860-48202882 CCTGGGCAGAGGAAGGGCTCAGG + Intronic
1158137494 18:54223932-54223954 CCTGGGCAGAGGATGAGCGCTGG - Intronic
1160017470 18:75155548-75155570 CGTGCAGAAAGGAAGGGAGCCGG + Intergenic
1160232526 18:77058729-77058751 CGTGGAGGGAGGAAAGTCGCAGG + Intronic
1160892446 19:1386387-1386409 CATGTACAGAGGAAAGACGCAGG - Intronic
1160900942 19:1428131-1428153 CGTCTAGAGAGGAAGGGCCCCGG + Intronic
1160951150 19:1667918-1667940 CCTGTGCAGAGGGAGGGCGCTGG + Intergenic
1160972387 19:1775457-1775479 CGTGGAGGCAGGGAGGGCGCGGG - Exonic
1161242251 19:3228829-3228851 CGGGGACAGCGGCAGGGGGCTGG + Intronic
1162028627 19:7907924-7907946 CATGGACAGAGCAGAGGCGCAGG + Intronic
1162726801 19:12694862-12694884 GCTGGGCAGAGGATGGGCGCTGG - Exonic
1164051362 19:21587525-21587547 GATGGACAGAGGATGGGCCCTGG - Intergenic
1165088075 19:33365051-33365073 CGTGGACTGAGGGAGGGAGTGGG + Intergenic
1165742008 19:38210323-38210345 CCAGGAGAGAGGAAGGGAGCAGG - Intergenic
1167195650 19:48026266-48026288 CTTGGACAGAGGAGGAGCCCTGG + Intergenic
1167264852 19:48478411-48478433 GGACGAGAGAGGAAGGGCGCAGG - Intronic
1167632355 19:50632822-50632844 CGAGGACAGAGGTAGGGGTCAGG + Intronic
925030268 2:645080-645102 CCTGCACAGAGGAAGTGCACTGG + Intergenic
925068947 2:951134-951156 CGTGGAGGGAGGAGGGGCGGGGG - Intronic
925395001 2:3527083-3527105 CCGGGACACAGGGAGGGCGCAGG + Intergenic
925580884 2:5409265-5409287 GGGGGAGAGAGGAAGGGGGCAGG + Intergenic
925616934 2:5752569-5752591 GCTGCACAGAGGAAGGGCGGAGG + Intergenic
925668863 2:6290504-6290526 GGTGGAGAGAGGAAGGGAGGAGG + Intergenic
926297458 2:11579066-11579088 CGAGGACGCAGGAAGGTCGCTGG + Intronic
927521033 2:23698248-23698270 GGTGGGCTGAGGAAGGGCTCAGG - Intronic
934530878 2:95087791-95087813 CTTGGATAGAGGAAGGGCCTTGG + Intronic
937151684 2:119690605-119690627 CGTGGAGAGAGGGAGGGAGCCGG + Intergenic
937917729 2:127107144-127107166 CGGGGACAGAGGGAGGGAGAGGG + Exonic
938044950 2:128110408-128110430 GGTGGGCAGAGGATGGGTGCTGG - Intronic
938110071 2:128558414-128558436 CCTGGACACAGGAAGGGGGTGGG - Intergenic
938149226 2:128867597-128867619 CGTGGGCAGAGGACAGTCGCTGG + Intergenic
938408369 2:131045117-131045139 GGTGGGCAGAGGAAGGACTCGGG + Intronic
938684505 2:133724545-133724567 CGTGGGCAGAGGAAAGTCCCAGG + Intergenic
939837733 2:147150730-147150752 CCTGGACACAGGAAGGGAACTGG + Intergenic
939953990 2:148509653-148509675 TGTGATCAGAGGAAGGGCGGAGG - Intronic
942523452 2:176828907-176828929 CGTGGACAGAGGTGAGGCTCAGG - Intergenic
943324965 2:186486535-186486557 CGTGGCCCGAGGAAGCGAGCCGG - Intronic
943501286 2:188693006-188693028 CTTGCACAGAGGTAGGGTGCTGG + Intergenic
944867157 2:203873809-203873831 CATGGACAGAAGAAGGCAGCAGG + Exonic
948273001 2:236688275-236688297 CAGGGACAGAGGCAGGGCCCGGG - Intergenic
948551735 2:238777589-238777611 CATGGAAAGAGGAAGGACGTTGG + Intergenic
1170756637 20:19211884-19211906 CGAGGCCAGAGGCTGGGCGCGGG + Intergenic
1172604747 20:36206918-36206940 GATGGCCCGAGGAAGGGCGCAGG - Intronic
1175503314 20:59465469-59465491 GGGAGACAGAGGAAGGGAGCAGG - Intergenic
1176182310 20:63756155-63756177 AGGGGACAGAGGAAGGGCCAAGG - Intronic
1176231642 20:64036067-64036089 AGTGGAGAGAGGGAGGGGGCAGG + Intronic
1180252194 21:46597125-46597147 GGTGGACAGGGGATGGGCCCGGG - Intergenic
1180515008 22:16132377-16132399 CGGGGACTGAAGAAGGGCGAGGG + Intergenic
1180558474 22:16596647-16596669 CGTGGAAAGGGGAAGGGTGATGG + Intergenic
1181089564 22:20463391-20463413 GGTGGACAGAGGACAGGGGCAGG + Intronic
1183264602 22:36817479-36817501 AGTGGAGAGAGAAAGGGAGCAGG - Intronic
1183506744 22:38213685-38213707 TGTGGAGAGAGGAAGGTGGCAGG + Intronic
1184857926 22:47156646-47156668 AGTGGACAGGAGAAGGGTGCAGG - Intronic
1184865415 22:47199416-47199438 CGTGGCCAGAGGGAGGGCGCGGG - Intergenic
1184893523 22:47393727-47393749 CTTGGACAGAGGAGGGGTGGGGG - Intergenic
1185394146 22:50578255-50578277 CCTGGACAGAGGCAGGGTTCGGG + Intronic
949517733 3:4822204-4822226 CATGCACAGAGGGAGGGAGCAGG + Intronic
951559327 3:23949821-23949843 GGTGGACAGAGGAAGTGTGAGGG + Intronic
953210705 3:40872585-40872607 CGGGGAAAGAGGAAGGCCACAGG + Intergenic
953423512 3:42773145-42773167 CGGGGAGAGCGGAAGGGCCCGGG - Intronic
953802502 3:46035962-46035984 AGTGGAGAGAGGAAGGACCCCGG + Intergenic
954589855 3:51774144-51774166 TGTGGACAGAGGAAAGGAGATGG + Intergenic
965375355 3:167916207-167916229 CGGGGAGAGAGGCAGGGGGCAGG + Intergenic
965956510 3:174377259-174377281 TGTGGACAGCGGAAGGGCGCCGG + Intergenic
968882370 4:3307981-3308003 CCTGGGCAGAGGAAGCGTGCAGG + Intronic
980234353 4:130085832-130085854 CATGGTCAGAGGAGGGGGGCGGG + Intergenic
982164928 4:152605542-152605564 CATGGACAGAGGACCTGCGCCGG - Intergenic
983939829 4:173527375-173527397 TCTGGACAGAGGAAAGGCGAGGG + Exonic
985444628 4:190015264-190015286 CGGGGAAAGAGGGAGGGAGCGGG - Intergenic
985656067 5:1131871-1131893 CGTGTACACAGCCAGGGCGCTGG - Intergenic
985731478 5:1551640-1551662 CCTCGACTGAGGAAGGGAGCAGG + Intergenic
985894909 5:2743206-2743228 AGCGGAGAGAGGAAGGGGGCTGG - Intergenic
986773482 5:10994300-10994322 CGGGGACGGAGGAAGGGGGCGGG + Intronic
986773520 5:10994378-10994400 CGGGGAAAGAGGAGGGGGGCGGG + Intronic
987225123 5:15831901-15831923 TGTGGACAGAGCAAGGGCCATGG - Intronic
989570798 5:42944321-42944343 CGTGGACAGACGACTGGGGCCGG + Intergenic
999196152 5:149782914-149782936 CTGGGACAGAGGTAGGGAGCAGG + Intronic
999768310 5:154756468-154756490 CGTCGGCAGAGGGTGGGCGCTGG + Intronic
1001103586 5:168834180-168834202 TGTGGAGACAGGAAGGGCTCAGG + Intronic
1002043903 5:176531721-176531743 CGTGGAGAAGGGAAGGGAGCCGG - Intronic
1002789132 6:424849-424871 CTGGGACAGAGGAAGGGGCCAGG + Intergenic
1003150441 6:3543400-3543422 CATGCACAGAGGGAGGGTGCAGG - Intergenic
1003716227 6:8649389-8649411 TGTGCACAGAGGAAAGGCCCAGG - Intergenic
1007634134 6:43287777-43287799 CTTTTACAGAGGAAGGGCTCAGG - Exonic
1012899762 6:104991996-104992018 CGTGGAAAGAGGGAGGGGGAGGG + Intronic
1013414501 6:109912802-109912824 AGTGGACAGAGGAGGGGGGGTGG - Intergenic
1016999009 6:149982716-149982738 CCAGGCCAGAGGAAGGGCTCAGG - Intergenic
1018803911 6:167244037-167244059 CGCTGACAGAGGAGGGGTGCTGG + Intergenic
1018888465 6:167962503-167962525 CGAGGCAAGAGGAAGAGCGCCGG + Exonic
1018910309 6:168097788-168097810 GGTGGACAGCGGAGGGGCCCGGG - Intergenic
1019454838 7:1121604-1121626 GGTGGTCAGCGGAAGGGAGCAGG - Intronic
1022902178 7:34821905-34821927 CCTGGGCAGAGGAAGGCAGCTGG - Intronic
1023608829 7:41954401-41954423 CCTGGAGAGGGGAAGGGGGCTGG + Intergenic
1023881966 7:44325758-44325780 CGTGTGCAGATGCAGGGCGCCGG - Intronic
1024201984 7:47117267-47117289 CTGGGAGAGAGGAAGGGCCCAGG - Intergenic
1025260585 7:57415095-57415117 CCTGTGCAGAGGAAGGGAGCTGG + Intergenic
1026850942 7:73722861-73722883 AGTGGACAAAGGAAGGATGCTGG + Intergenic
1027183121 7:75953305-75953327 CGTGGAAAGAGGGAGGGGGAGGG + Intronic
1029457562 7:100678886-100678908 CGTGGCCCGGGGAAGGGGGCTGG - Exonic
1034455890 7:151169570-151169592 GGTGGACTGAGGAAGGGGGCAGG + Intronic
1034618843 7:152441349-152441371 CGTGGAAAGGGGAAGGGCGATGG - Intergenic
1034884141 7:154784775-154784797 TGTGGACTGAGGTAGGGAGCTGG - Intronic
1035274212 7:157737697-157737719 CCTCCACAGAGGAAGGGCCCTGG + Intronic
1037753411 8:21696929-21696951 AGGGGACAGAGGAAGGGGGAGGG + Intronic
1039212654 8:35235236-35235258 CGCGGAGAGAGGAAGCGGGCTGG - Intergenic
1039858427 8:41436249-41436271 AGTGGACAGAGGCAGGCAGCAGG - Intergenic
1041906528 8:63038973-63038995 CGGGGACAGAGCAATGGGGCGGG - Exonic
1044854574 8:96461871-96461893 CCTGGACAGAGGCAGGGAACTGG + Intergenic
1046379065 8:113430470-113430492 AGTGGAAAGAGCAAGGGCTCTGG - Intronic
1047439483 8:124864334-124864356 CGAGGACAGATGAAGTGAGCTGG + Intergenic
1049223057 8:141436601-141436623 CTTTGGCAGAGGAAGGGAGCTGG + Intergenic
1049341485 8:142114882-142114904 GGAGGACAGAGGGAGGGAGCTGG + Intergenic
1049601183 8:143508358-143508380 CCTGCACAGGGGAGGGGCGCTGG + Intronic
1049844158 8:144792092-144792114 CGTGGACAGAGGAAGGGCGCCGG - Exonic
1050194231 9:3063651-3063673 TGAGAACAGAGGAAGGGTGCTGG + Intergenic
1050985644 9:12078671-12078693 CTTGGACAGAGGAAGGGGGTGGG - Intergenic
1052797507 9:32936952-32936974 CTAGGACAGAGGAAGGGCTAGGG + Intergenic
1053073005 9:35111909-35111931 CCTGGAAGGAGGAAGGGCGGGGG - Intronic
1053707239 9:40768115-40768137 CGGGGACTGAAGAAGGGCGAGGG - Intergenic
1054417154 9:64888883-64888905 CGGGGACTGAAGAAGGGCGAGGG - Intergenic
1055343643 9:75311588-75311610 CTTGGACACAGGAAGGGGGAAGG - Intergenic
1055691134 9:78831898-78831920 TGTGGACAGAGCAAGGGAACTGG - Intergenic
1056553544 9:87671091-87671113 CGGGGACAGAGGACGGGAGAAGG - Intronic
1056935395 9:90912079-90912101 GGTGGCCAGAGGGACGGCGCTGG - Intergenic
1060216673 9:121742634-121742656 TGTGGACAGTGGAAGGGCCTCGG + Intronic
1060218438 9:121752135-121752157 CTTGGACAGAGCAAGGGCAGGGG + Intronic
1060406560 9:123375839-123375861 CCTGGACAGACGAAGGCAGCAGG + Intronic
1060724766 9:125999460-125999482 TGGGGAGAGAGGAAAGGCGCAGG + Intergenic
1061003783 9:127917024-127917046 CGCGGCCAGAGGCAGGGGGCGGG + Exonic
1061262874 9:129489725-129489747 GGGGGACAGAGGAAAGGAGCCGG - Intergenic
1062344541 9:136108897-136108919 CGTGGTCAGAGGATGGGTGCTGG - Intergenic
1062374755 9:136256871-136256893 TGGGGACAGAGGCAGGGAGCAGG + Intergenic
1062475666 9:136725754-136725776 TGTGCACAAAGGAAGGGCCCTGG - Intergenic
1062588934 9:137264283-137264305 CGTGGACAGCAAGAGGGCGCGGG + Exonic
1186893769 X:13986191-13986213 GGTGGACAGAGGATGTGAGCTGG + Intergenic
1188743916 X:33817929-33817951 AGTGGACAGAGGAAAGACACAGG - Intergenic
1190322726 X:49188058-49188080 TGTGGAGGGAGGGAGGGCGCAGG + Exonic
1195348555 X:103975824-103975846 TGTGGACAGGGGAAGGGTGGGGG - Intergenic
1195358887 X:104063016-104063038 TGTGGACAGGGGAAGGGTGGGGG + Intergenic
1198395016 X:136211889-136211911 CGTGGGCAGAGGCAGGGGGTTGG + Intergenic
1198502039 X:137259944-137259966 AGTGGAAAGAGGAAGGGGACTGG - Intergenic