ID: 1049844158

View in Genome Browser
Species Human (GRCh38)
Location 8:144792092-144792114
Sequence CGTGGACAGAGGAAGGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 228}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049844158_1049844164 -6 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844164 8:144792109-144792131 TCCACGGATCACACGGCCCATGG 0: 1
1: 0
2: 1
3: 1
4: 54
1049844158_1049844175 29 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844175 8:144792144-144792166 GGGGCGACTCACGATTAGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 11
1049844158_1049844168 7 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844168 8:144792122-144792144 CGGCCCATGGCGACGGGTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 79
1049844158_1049844170 9 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 94
1049844158_1049844172 10 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844172 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 2
3: 9
4: 86
1049844158_1049844169 8 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844169 8:144792123-144792145 GGCCCATGGCGACGGGTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1049844158_1049844166 0 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844166 8:144792115-144792137 GATCACACGGCCCATGGCGACGG 0: 1
1: 0
2: 0
3: 2
4: 53
1049844158_1049844167 1 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844167 8:144792116-144792138 ATCACACGGCCCATGGCGACGGG 0: 1
1: 0
2: 0
3: 1
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049844158 Original CRISPR CGTGGACAGAGGAAGGGCGC CGG (reversed) Exonic