ID: 1049844161

View in Genome Browser
Species Human (GRCh38)
Location 8:144792099-144792121
Sequence TGTGATCCGTGGACAGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 175}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049844161_1049844177 27 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 15
1049844161_1049844170 2 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 94
1049844161_1049844178 30 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844178 8:144792152-144792174 TCACGATTAGCGCGGCCGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 15
1049844161_1049844168 0 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844168 8:144792122-144792144 CGGCCCATGGCGACGGGTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 79
1049844161_1049844167 -6 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844167 8:144792116-144792138 ATCACACGGCCCATGGCGACGGG 0: 1
1: 0
2: 0
3: 1
4: 48
1049844161_1049844166 -7 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844166 8:144792115-144792137 GATCACACGGCCCATGGCGACGG 0: 1
1: 0
2: 0
3: 2
4: 53
1049844161_1049844176 26 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844176 8:144792148-144792170 CGACTCACGATTAGCGCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 2
1049844161_1049844172 3 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844172 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 2
3: 9
4: 86
1049844161_1049844175 22 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844175 8:144792144-144792166 GGGGCGACTCACGATTAGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 11
1049844161_1049844169 1 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844169 8:144792123-144792145 GGCCCATGGCGACGGGTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049844161 Original CRISPR TGTGATCCGTGGACAGAGGA AGG (reversed) Exonic
900826461 1:4931034-4931056 TTGAATCCGTGGACTGAGGAAGG - Intergenic
900926550 1:5709723-5709745 TGTCATCAGTGGGCACAGGATGG + Intergenic
900981290 1:6047685-6047707 AGTGTCCCGTGCACAGAGGAGGG - Intronic
901064368 1:6487897-6487919 TGAGATCAGTGAACAGATGAAGG + Intronic
901397223 1:8990131-8990153 TGTGCTCCCTGGGGAGAGGAAGG + Intergenic
901765072 1:11494872-11494894 TGTCATCCTTTGCCAGAGGAGGG + Intronic
903391451 1:22966435-22966457 TGTGTACTGAGGACAGAGGAGGG - Intergenic
904989744 1:34582565-34582587 TGTGCTCAGTAAACAGAGGAGGG + Intergenic
905275883 1:36817789-36817811 TGTGAGGCTGGGACAGAGGAAGG - Intronic
906050536 1:42867758-42867780 TATGATCAGTTGACAGAGGAAGG + Intergenic
908326075 1:63024970-63024992 TGTTCTACGTGGACACAGGAAGG + Intergenic
910349592 1:86280579-86280601 TATGATCAGCTGACAGAGGAAGG + Intergenic
918445345 1:184611652-184611674 GGTGTTAGGTGGACAGAGGAGGG + Intronic
919801005 1:201354628-201354650 TGTGATCTGGGGACTGTGGATGG + Intergenic
920858526 1:209685400-209685422 TGTGATCTCTGGACTAAGGAAGG - Intergenic
921043726 1:211459301-211459323 TGAGAACCTTGGACACAGGAAGG + Intergenic
921067333 1:211632232-211632254 TGGGGCCTGTGGACAGAGGAGGG + Intergenic
924440068 1:244078549-244078571 TGAGATGCATGGACAGAGCATGG - Intergenic
1064057481 10:12109958-12109980 TGTGGTCCATGGACACAGGTTGG - Intronic
1064952846 10:20873427-20873449 TATGATCTGAGGACAGAGTAGGG - Intronic
1068632177 10:59309328-59309350 TGTGAACGGTGGCCTGAGGAGGG - Intronic
1072417781 10:95263288-95263310 TCTGATCTGGGGACAGAGGCAGG - Intronic
1075900350 10:126038069-126038091 TGTGATCTGGGGCCAGAGGGAGG - Intronic
1076751220 10:132544343-132544365 TGTGTGCCGGGCACAGAGGATGG + Intronic
1076799240 10:132813052-132813074 TGTGATCAGAGCACAGAGGAGGG - Intronic
1076982455 11:212000-212022 TGTACTTCGTGGACAGAGCAGGG - Intronic
1077443109 11:2577878-2577900 GGGGAGCCGTGGACAGAGGGAGG - Intronic
1077776359 11:5276365-5276387 AGTGATCCATGGACACAGGGAGG + Intronic
1078837566 11:15045829-15045851 TCTGGTCCTTGGAAAGAGGAAGG + Intronic
1081622036 11:44624374-44624396 TGTGATGCAAGGGCAGAGGATGG - Intergenic
1083331251 11:61899375-61899397 GGTGATCTGTGGGCAGAGGTGGG + Exonic
1088108062 11:106228009-106228031 TCTGAACAGTGGAAAGAGGATGG + Intergenic
1088806520 11:113358206-113358228 GGTGATCAGTGGGAAGAGGAGGG + Intronic
1088932637 11:114367405-114367427 TCAGCTCCGTGGGCAGAGGAGGG + Intergenic
1092731939 12:11542966-11542988 TGTGCTCCAGGGAAAGAGGAGGG - Intergenic
1093805826 12:23431892-23431914 TGTGATCAGTTGCCAGAAGATGG + Intergenic
1096642298 12:53004139-53004161 TGTTTTCCCTGGAAAGAGGAGGG + Intergenic
1096677450 12:53233308-53233330 TGGGATCCGTGCACAGAGCTTGG - Intergenic
1097544555 12:60982726-60982748 TTTGACCCATGGAAAGAGGATGG - Intergenic
1099735825 12:86565355-86565377 TATGATCAGTTGACAGAGGAAGG + Intronic
1101652862 12:106693610-106693632 TGGGATCAGGGGACAGTGGAGGG + Intronic
1102927307 12:116836091-116836113 TGAGATCTGTGGGCTGAGGAAGG - Intronic
1104820634 12:131675437-131675459 TGACATCCGAGGAGAGAGGACGG + Intergenic
1108527090 13:51294631-51294653 TGTGATCCCTGGAGAGAGTATGG - Intergenic
1108631032 13:52282458-52282480 CGTGATTCATGGACACAGGAAGG + Intergenic
1108655658 13:52530134-52530156 CGTGATTCATGGACACAGGAAGG - Intergenic
1108996678 13:56743193-56743215 TGTGAGAAGTGGAAAGAGGATGG - Intergenic
1109407955 13:61925417-61925439 TGTGACCCAGGCACAGAGGATGG + Intergenic
1115043628 14:28961569-28961591 TGTGGTCCTTAGACACAGGAAGG - Intergenic
1115059755 14:29174212-29174234 TATGAGCAGTTGACAGAGGAAGG + Intergenic
1116759515 14:48993835-48993857 TGCTATCCGGGGACAAAGGAGGG + Intergenic
1117966578 14:61212839-61212861 AGTGCTCCGTGAGCAGAGGAGGG + Intronic
1118696087 14:68386638-68386660 TGGGATTAGAGGACAGAGGAAGG - Intronic
1118811685 14:69279715-69279737 TGTGCTTGGTGGACACAGGAAGG + Intronic
1119164082 14:72477893-72477915 TGTGAAAGGTGGGCAGAGGAGGG + Intronic
1121745787 14:96290034-96290056 TGTTCTCAGTGAACAGAGGAGGG - Intronic
1122046804 14:99029792-99029814 TGTGAGCTGAGGACAGAGGTCGG - Intergenic
1122366173 14:101196102-101196124 TGGGCTCCGTAAACAGAGGAGGG - Intergenic
1129983994 15:79900292-79900314 TGTCATGCCTTGACAGAGGAAGG + Intronic
1129990930 15:79962375-79962397 TGTCATGCCTTGACAGAGGAAGG + Intronic
1131689226 15:94808567-94808589 TGGGATCCTGGGACAGAAGAAGG + Intergenic
1133492051 16:6279840-6279862 TGGGATCTGGGGAGAGAGGAAGG + Intronic
1136552400 16:30988736-30988758 TGGGATGAGAGGACAGAGGAAGG - Exonic
1140207911 16:72948492-72948514 TGTGATCCGTGGACACAGTTTGG + Intronic
1141581486 16:85002634-85002656 TGGGATCCTGGGACAGAGAAAGG + Intronic
1142185012 16:88690715-88690737 TGGGATCTGGGGACGGAGGATGG - Intergenic
1145780433 17:27559607-27559629 TGTGCTCCTGGGGCAGAGGAAGG - Intronic
1147644919 17:42027805-42027827 TATGAGCTGTGGATAGAGGAAGG - Intronic
1148006805 17:44438830-44438852 TCTCAGCCGGGGACAGAGGAAGG + Intronic
1151370136 17:73642592-73642614 TGTGATCTGGGGGCAGAGGCAGG - Intronic
1156528990 18:37796855-37796877 TGTTTTCCATGGACAGAGGAAGG - Intergenic
1159711342 18:71764438-71764460 TATGATTAGTTGACAGAGGAAGG + Intronic
1161009958 19:1955237-1955259 TGTGTTCCGTGGGCACAGGGCGG - Intronic
1161029698 19:2051889-2051911 TGCTATTCGAGGACAGAGGAAGG - Intergenic
1163753636 19:19093513-19093535 TGGGATCCTTGGACAGAGAAAGG - Intronic
1164711030 19:30357383-30357405 AGTGATCCCTGGGGAGAGGATGG + Intronic
1165069600 19:33247901-33247923 TGTGGGCCTTGGAGAGAGGATGG - Intergenic
1166902114 19:46072624-46072646 TGTGATCAGGAGACAGAGGCAGG + Intronic
1168599459 19:57706382-57706404 AGTGTTAAGTGGACAGAGGAAGG - Intronic
925899270 2:8496747-8496769 TATGATCCCTGGTCAGGGGAGGG - Intergenic
926437977 2:12856765-12856787 TGCTATGCGTGCACAGAGGAGGG - Intergenic
935183982 2:100715215-100715237 TGTGATCAGTTGACAGAGGAAGG + Intergenic
935221645 2:101020480-101020502 TATGATCAGTTGACAGAGAAAGG + Intronic
944082645 2:195805833-195805855 TGTGTTCAGTGAACAGAGTAGGG + Intronic
945421835 2:209647711-209647733 AGTGATCAGTGGTCAGAGGTTGG + Intronic
1170937658 20:20823945-20823967 TGTGATCACCTGACAGAGGAGGG - Intergenic
1172411304 20:34725467-34725489 TGTGATCAGAGGAATGAGGACGG + Intronic
1172672119 20:36641760-36641782 TGTGATCCCGGGTCAGAGAAAGG - Intronic
1173682056 20:44890368-44890390 TTTCCTACGTGGACAGAGGAAGG - Intronic
1173842337 20:46166053-46166075 TGAGATCCGGGGACAGGGAAGGG - Intergenic
1178012704 21:28305492-28305514 TATGATCAGTTGACAGAGGAAGG + Intergenic
1178725138 21:35044737-35044759 TGAGATGCTGGGACAGAGGACGG - Intronic
1179383588 21:40921380-40921402 TATGATCAGGTGACAGAGGAAGG + Intergenic
1179624382 21:42640254-42640276 TGGGATCCTGGGACAGAGAAAGG + Intergenic
1179720577 21:43314029-43314051 TGTGACCCTGGGACAGAGGAAGG + Intergenic
1180539011 22:16423846-16423868 TGCGGTGCGAGGACAGAGGATGG - Intergenic
1180972286 22:19821898-19821920 AGTGAGCCCTGGACAGAGGGCGG - Intronic
1180982869 22:19887297-19887319 CGGGATTCGTGGGCAGAGGAAGG + Intronic
1181421453 22:22802122-22802144 TGGGTTCTGTGGACAGAGGTAGG - Intronic
1181486384 22:23234400-23234422 GGTGATCAGTGGCCTGAGGAGGG + Intronic
1183199353 22:36375149-36375171 TCTGATGGGTGGACAGATGAAGG + Intronic
951794844 3:26527006-26527028 TGAGATACGTGGACACAGGGAGG - Intergenic
952550047 3:34466512-34466534 TGAGATCAGTGGACACAGGGTGG - Intergenic
953109704 3:39922032-39922054 TATGAACAGTGGACAGAAGAAGG + Intronic
953470447 3:43161788-43161810 TGGGATCAGTGGACAGATCAGGG + Intergenic
953535121 3:43771396-43771418 AGTGGTCTGTGTACAGAGGAGGG + Intergenic
953703963 3:45217514-45217536 AGTGATCCAAGGAGAGAGGATGG + Intergenic
954360174 3:50117918-50117940 TGTGCTCCCAGGACAGAGCAGGG - Intronic
954610180 3:51940939-51940961 TGTGTTCTGGGAACAGAGGAGGG - Intronic
956718145 3:72096324-72096346 TGGGATTCGAGCACAGAGGATGG - Intergenic
956881881 3:73519323-73519345 TGTGATTCATGGTAAGAGGAGGG + Intronic
957384849 3:79483055-79483077 TGTGGTCAGTGGACAGAGCAGGG - Intronic
959203612 3:103278930-103278952 AATGATCAGTTGACAGAGGAAGG - Intergenic
962393348 3:134992567-134992589 GGTGATCCCTGCACAGCGGAAGG + Intronic
962554648 3:136535404-136535426 TGTGATCCCAGCACACAGGAAGG + Intronic
962850869 3:139307357-139307379 TGAGATCTGTGAACACAGGAGGG + Intronic
964532841 3:157686349-157686371 TTTGATGAGTGGAGAGAGGAAGG + Intergenic
965207835 3:165744438-165744460 TATGATCAGATGACAGAGGAAGG + Intergenic
967942879 3:194779849-194779871 TGTGCTCAGAGCACAGAGGAGGG - Intergenic
968470666 4:781096-781118 CGTGAGCCGGGGACAGTGGAGGG - Intergenic
969471003 4:7389314-7389336 TGTGATCCCGGGACAGGCGAGGG + Intronic
971080998 4:23211009-23211031 TGTGATCTGTGGACAGCAGTTGG + Intergenic
975742178 4:77440017-77440039 TATGATCAGTTGACAGAGGAAGG + Intergenic
976361892 4:84189436-84189458 TGTCATCTTTGGACAGAGAATGG - Intergenic
978311119 4:107385973-107385995 TCTGAGCAGTGGAAAGAGGACGG + Intergenic
978854213 4:113374859-113374881 TGTGGTACTTGGAGAGAGGATGG + Intronic
979765981 4:124464260-124464282 TGTTATTCATGGACACAGGAAGG + Intergenic
980387903 4:132110865-132110887 TATGATCAGTTGACAGAGGAAGG - Intergenic
983183744 4:164678046-164678068 TGGGATCTGAGCACAGAGGAAGG - Intergenic
983185109 4:164691890-164691912 TGTGATCAGTTGACAGAGGAAGG + Intergenic
985826685 5:2197126-2197148 TCTGCTCCGTGGACACAGGCAGG - Intergenic
986698395 5:10378898-10378920 TATGATCAGTTGACAGAGGAAGG + Intronic
988486929 5:31675026-31675048 TGGGATCTGAGGAGAGAGGATGG + Intronic
990728025 5:58777785-58777807 TGAGAACCTTGGACACAGGAAGG - Intronic
991445621 5:66697047-66697069 TGCGATCGGTGGACAGACTATGG + Intronic
993570834 5:89536885-89536907 TGTTATTAGTGGACAGAGAAAGG - Intergenic
994727448 5:103453308-103453330 TGAGTTCTGGGGACAGAGGAGGG - Intergenic
999867231 5:155714135-155714157 TGTGACACATGGACATAGGAAGG - Intergenic
1000139757 5:158390686-158390708 GGTGAAATGTGGACAGAGGAAGG + Intergenic
1002386955 5:178875529-178875551 TGCTACCCTTGGACAGAGGAAGG - Intronic
1003373256 6:5549480-5549502 TGTGATCCAAGGACTGAGGATGG - Intronic
1004553063 6:16668384-16668406 TGTGTTCCATGGACACAGGAAGG - Intronic
1005069207 6:21849044-21849066 TCTGATCTGTGGACAAAGGCTGG - Intergenic
1005095641 6:22112162-22112184 GGTGATCAGTGGAGAGGGGATGG - Intergenic
1006145729 6:31958637-31958659 TGTGATCCCTGGAGACAGGAGGG - Intronic
1006511332 6:34522964-34522986 TGCAATCAGTGGACTGAGGAAGG - Intronic
1006939463 6:37742417-37742439 TGTGAACAGAGGACAGAGGCCGG + Intergenic
1007072178 6:39045951-39045973 TGTGATGCTAGGACAGAGTATGG - Intergenic
1009585420 6:65595319-65595341 TGTGGTAGGTGGACAGGGGAGGG + Intronic
1010867829 6:81001880-81001902 TGAGAACCATGGACACAGGAAGG + Intergenic
1011411152 6:87067835-87067857 TGTGATCTGAGGAAAAAGGAAGG + Intergenic
1011745748 6:90406418-90406440 TAAGATCAGTGGAAAGAGGAAGG + Intergenic
1012640882 6:101611806-101611828 TGTGACCCGTGGACACACCATGG - Intronic
1014417029 6:121195703-121195725 TATGATCAGTTGACAGAGGAAGG + Intronic
1015475536 6:133655861-133655883 TATGATCAGTTGACAGAGGAAGG + Intergenic
1018122879 6:160654905-160654927 TATGATCAGTTGACAGAGGAAGG - Intronic
1019400350 7:848633-848655 TGTGATTGGTGGAAAAAGGAGGG - Intronic
1019792970 7:3029337-3029359 TGAGATCCGTGGACACAGGGAGG + Intronic
1019793067 7:3029912-3029934 TGAGATCTGTGGACACAGGGAGG + Intronic
1019935792 7:4256714-4256736 TGAAAGCCGTGGACAGAGGCAGG + Intronic
1021874310 7:25034236-25034258 TGAGATCCGGGGACAGAAAAAGG - Intergenic
1021887881 7:25157754-25157776 TGGGATCCTGGGACAGAAGAAGG + Intronic
1022481334 7:30745037-30745059 GGTGAGCAGTGGCCAGAGGATGG + Intronic
1022835921 7:34114685-34114707 TGTGGTCCTTGGCCACAGGAAGG + Intronic
1022851336 7:34265745-34265767 TGTGGTCGGGGGACAGGGGAGGG - Intergenic
1023108030 7:36782317-36782339 GGTGGTCCGTGCTCAGAGGAGGG - Intergenic
1023147218 7:37163533-37163555 TGAGATCAATGGACACAGGAAGG - Intronic
1023607813 7:41945805-41945827 TGGGATGCGTGAAGAGAGGATGG + Intergenic
1024115365 7:46187673-46187695 AGTGAAGAGTGGACAGAGGAAGG - Intergenic
1025950393 7:66140708-66140730 TGTAATCTGTGGAGAGAGAAAGG + Intronic
1031367247 7:120917739-120917761 TTTCATCCTTGGACAGAGGCAGG - Intergenic
1034140271 7:148808997-148809019 TGTGAACTCTGGACAAAGGAGGG - Intronic
1035452952 7:158990303-158990325 TATGTGCCGTGGACACAGGAGGG + Intergenic
1040573346 8:48628501-48628523 TGGGATCCTGGGACAGAAGAAGG - Intergenic
1041274832 8:56146341-56146363 TGAGAACCTTGGACACAGGAAGG - Intergenic
1047024682 8:120812293-120812315 TGCGCTCTGGGGACAGAGGAGGG - Intronic
1048295282 8:133209489-133209511 TGGCATCCCTGGGCAGAGGAGGG - Intronic
1048507874 8:135036788-135036810 CGTGAGGCGTGGTCAGAGGAAGG + Intergenic
1049238085 8:141522739-141522761 TGTGTTCTCTGGACAGAGGAGGG - Intergenic
1049844161 8:144792099-144792121 TGTGATCCGTGGACAGAGGAAGG - Exonic
1050123960 9:2337219-2337241 TGAGATCCTTGGACACACGATGG + Intergenic
1055101300 9:72468303-72468325 TGAGATCAGTGGACAGGGAAGGG - Intergenic
1057725399 9:97564723-97564745 TGTGATCCCGGGGCAGGGGAGGG + Intronic
1058870161 9:109194450-109194472 TGTGAGGAGTGGACGGAGGATGG + Intronic
1059579374 9:115527569-115527591 TGAGATCCATGGACACAGGAAGG - Intergenic
1059882389 9:118705898-118705920 TGTGATCAATGGGCAGAGCAGGG + Intergenic
1061712414 9:132497463-132497485 TGTGGCCTGTGGACAGTGGAAGG + Intronic
1062073440 9:134571732-134571754 TGTGCTTTGAGGACAGAGGAAGG - Intergenic
1062344544 9:136108904-136108926 GGAGGTCCGTGGTCAGAGGATGG - Intergenic
1186034586 X:5407981-5408003 TGTGAGCCGTGAATATAGGATGG - Intergenic
1186076434 X:5884625-5884647 TGGTATCCGAGGACAGAGGAAGG + Intronic
1186624208 X:11274821-11274843 TGTGGTTCCTGGACACAGGAAGG - Intronic
1187603386 X:20858183-20858205 TGTGATACGTAGACTGTGGATGG + Intergenic
1188203668 X:27324404-27324426 TATATTCCGTGGACACAGGAAGG - Intergenic
1189304098 X:39973910-39973932 TGTGGCCTGTGGACAAAGGAAGG - Intergenic
1192256544 X:69465455-69465477 TGTAAACAGTGGAAAGAGGAGGG - Intergenic
1192673213 X:73168102-73168124 TATGATCAGTTGGCAGAGGAAGG - Intergenic
1195764746 X:108284261-108284283 TGAGAACCGTGGACACAGGGAGG + Intronic
1197268440 X:124400712-124400734 TGTTATCCATGGACATAGCAAGG + Intronic
1199375077 X:147098590-147098612 TGTAATCCTTGAATAGAGGAAGG + Intergenic
1201957717 Y:19644762-19644784 TGTGATCCTTTGGCAGAGAAGGG + Intergenic