ID: 1049844161

View in Genome Browser
Species Human (GRCh38)
Location 8:144792099-144792121
Sequence TGTGATCCGTGGACAGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 175}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049844161_1049844176 26 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844176 8:144792148-144792170 CGACTCACGATTAGCGCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 2
1049844161_1049844167 -6 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844167 8:144792116-144792138 ATCACACGGCCCATGGCGACGGG 0: 1
1: 0
2: 0
3: 1
4: 48
1049844161_1049844169 1 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844169 8:144792123-144792145 GGCCCATGGCGACGGGTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1049844161_1049844175 22 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844175 8:144792144-144792166 GGGGCGACTCACGATTAGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 11
1049844161_1049844166 -7 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844166 8:144792115-144792137 GATCACACGGCCCATGGCGACGG 0: 1
1: 0
2: 0
3: 2
4: 53
1049844161_1049844170 2 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 94
1049844161_1049844177 27 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 15
1049844161_1049844178 30 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844178 8:144792152-144792174 TCACGATTAGCGCGGCCGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 15
1049844161_1049844168 0 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844168 8:144792122-144792144 CGGCCCATGGCGACGGGTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 79
1049844161_1049844172 3 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844172 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 2
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049844161 Original CRISPR TGTGATCCGTGGACAGAGGA AGG (reversed) Exonic