ID: 1049844164

View in Genome Browser
Species Human (GRCh38)
Location 8:144792109-144792131
Sequence TCCACGGATCACACGGCCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 54}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049844158_1049844164 -6 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844164 8:144792109-144792131 TCCACGGATCACACGGCCCATGG 0: 1
1: 0
2: 1
3: 1
4: 54
1049844157_1049844164 -5 Left 1049844157 8:144792091-144792113 CCCGGCGCCCTTCCTCTGTCCAC 0: 1
1: 1
2: 0
3: 29
4: 287
Right 1049844164 8:144792109-144792131 TCCACGGATCACACGGCCCATGG 0: 1
1: 0
2: 1
3: 1
4: 54
1049844154_1049844164 30 Left 1049844154 8:144792056-144792078 CCTTTACGGTGCTTCACGTGCGC 0: 1
1: 0
2: 1
3: 1
4: 12
Right 1049844164 8:144792109-144792131 TCCACGGATCACACGGCCCATGG 0: 1
1: 0
2: 1
3: 1
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049844164 Original CRISPR TCCACGGATCACACGGCCCA TGG Exonic