ID: 1049844164 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:144792109-144792131 |
Sequence | TCCACGGATCACACGGCCCA TGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 57 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 1, 4: 54} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1049844158_1049844164 | -6 | Left | 1049844158 | 8:144792092-144792114 | CCGGCGCCCTTCCTCTGTCCACG | 0: 1 1: 0 2: 2 3: 20 4: 228 |
||
Right | 1049844164 | 8:144792109-144792131 | TCCACGGATCACACGGCCCATGG | 0: 1 1: 0 2: 1 3: 1 4: 54 |
||||
1049844157_1049844164 | -5 | Left | 1049844157 | 8:144792091-144792113 | CCCGGCGCCCTTCCTCTGTCCAC | 0: 1 1: 1 2: 0 3: 29 4: 287 |
||
Right | 1049844164 | 8:144792109-144792131 | TCCACGGATCACACGGCCCATGG | 0: 1 1: 0 2: 1 3: 1 4: 54 |
||||
1049844154_1049844164 | 30 | Left | 1049844154 | 8:144792056-144792078 | CCTTTACGGTGCTTCACGTGCGC | 0: 1 1: 0 2: 1 3: 1 4: 12 |
||
Right | 1049844164 | 8:144792109-144792131 | TCCACGGATCACACGGCCCATGG | 0: 1 1: 0 2: 1 3: 1 4: 54 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1049844164 | Original CRISPR | TCCACGGATCACACGGCCCA TGG | Exonic | ||