ID: 1049844165

View in Genome Browser
Species Human (GRCh38)
Location 8:144792110-144792132
Sequence GCCATGGGCCGTGTGATCCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 55}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049844165_1049844175 11 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844175 8:144792144-144792166 GGGGCGACTCACGATTAGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 11
1049844165_1049844178 19 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844178 8:144792152-144792174 TCACGATTAGCGCGGCCGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 15
1049844165_1049844180 25 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844180 8:144792158-144792180 TTAGCGCGGCCGGGCGGCCCGGG 0: 1
1: 0
2: 1
3: 7
4: 92
1049844165_1049844177 16 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 15
1049844165_1049844169 -10 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844169 8:144792123-144792145 GGCCCATGGCGACGGGTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1049844165_1049844170 -9 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 94
1049844165_1049844172 -8 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844172 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 2
3: 9
4: 86
1049844165_1049844179 24 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844179 8:144792157-144792179 ATTAGCGCGGCCGGGCGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 59
1049844165_1049844176 15 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844176 8:144792148-144792170 CGACTCACGATTAGCGCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 2

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049844165 Original CRISPR GCCATGGGCCGTGTGATCCG TGG (reversed) Exonic
902374494 1:16023907-16023929 GCCATCGGGTGTGTGGTCCGAGG + Exonic
904274107 1:29369303-29369325 GCCTCTGGCCGTGTGATGCGGGG - Intergenic
905869825 1:41396811-41396833 GCCCTGGGCCATGGGATCCTGGG + Intergenic
919713238 1:200749331-200749353 GCCATGGGCATTGTGTTCCTTGG + Intronic
922037045 1:221858963-221858985 GCCAAGGGCTGTGTCATCCCTGG + Intergenic
1064600845 10:16990868-16990890 ACAATGGACCGTGTGAGCCGTGG + Intronic
1064982107 10:21174651-21174673 CCCAAGGGCCGGGAGATCCGCGG + Intergenic
1065128865 10:22600656-22600678 CTCCTGGGCCGTGTGATTCGAGG - Intronic
1076758417 10:132587426-132587448 GGCATGGCCTGTGTGATTCGAGG + Intronic
1078822561 11:14896418-14896440 GCCATGGTCCCTGTGTTCCTGGG + Intergenic
1104837578 12:131801534-131801556 GCCATGGCCCGTGTTTGCCGTGG + Intergenic
1121467855 14:94127598-94127620 GAGATGGGCCGTGTGACCCAGGG - Intergenic
1130897682 15:88183666-88183688 GCCCTGGGGCGTGTGAGCCCAGG - Intronic
1133221694 16:4321667-4321689 GCCAGGGGCCGTGGGAACTGGGG + Intronic
1133237164 16:4392712-4392734 GCCAGGGCCGGTGTGAGCCGAGG - Intronic
1134139574 16:11706379-11706401 GCCCTGGGCCCTGTGATCGTCGG + Intronic
1138093389 16:54194338-54194360 GCCATGGCCCGTGTGGCCCGGGG - Intergenic
1138618046 16:58187795-58187817 GCCATGGGCTCTGTGATCTTGGG - Intronic
1139270024 16:65673211-65673233 GCCATGAGCATTGTGATCCTTGG - Intergenic
1139544820 16:67645229-67645251 GCCATGGGCCGGGCGGGCCGGGG - Exonic
1141721765 16:85759875-85759897 GGCATGGGCAGTGTGATCCTCGG + Intergenic
1157435925 18:47669157-47669179 GGCATGGGCAGTGTGATCTGAGG + Intergenic
1164609940 19:29624986-29625008 CCCACTGGCCATGTGATCCGGGG - Intergenic
1165136486 19:33673100-33673122 GCCCAGGGCTGTGTGGTCCGTGG + Intronic
1168386066 19:55964146-55964168 GCCAGGGGCCATGTGATGCCTGG - Intronic
925426681 2:3754451-3754473 GCCATGAGCCGTGTCCTCTGTGG + Intronic
932812003 2:74833888-74833910 GAGATGGGACGTGTGGTCCGTGG - Intergenic
938343260 2:130549261-130549283 GCCATGGGCTGTGTGCTCCCGGG - Intronic
938346573 2:130571461-130571483 GCCATGGGCTGTGTGCTCCCGGG + Intronic
938422294 2:131154992-131155014 GCTATGGGCCGTGGGCTGCGAGG + Intronic
1170121443 20:12916837-12916859 GCCCTGGGCCCTGTGAACTGTGG + Intergenic
1175551508 20:59820865-59820887 GCCATGGGCTGAGTGAGCCCAGG + Intronic
1176515690 21:7781769-7781791 GCCATGGGCCCTGTGTGCCATGG + Intergenic
1178649718 21:34411781-34411803 GCCATGGGCCCTGTGTGCCATGG + Intergenic
1179782699 21:43712482-43712504 GGCGTGGGGTGTGTGATCCGTGG - Intergenic
1183315742 22:37136020-37136042 GCCATGGGCCTTGTGAGTTGGGG - Intronic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
1185366540 22:50439477-50439499 CCCATGGGGCGTGTGACCTGGGG - Intronic
950190095 3:10970582-10970604 GCCATTGGCTGTGCCATCCGGGG - Intergenic
950640574 3:14345782-14345804 GCCAGAGGCCGTGGGATCCTGGG - Intergenic
954972531 3:54663358-54663380 TCCAGGGGCAGTGTGAGCCGAGG + Intronic
955753921 3:62208945-62208967 GCCATGGGCCGTGTGGCTCTGGG - Intronic
957723173 3:84031331-84031353 GCCATGGGCCTTTGGATCCCTGG + Intergenic
959663525 3:108896148-108896170 GCCAGGGGCTGTGGGGTCCGGGG + Intergenic
974356124 4:60814786-60814808 ACCATGGGCCGTTTGCTCTGTGG + Intergenic
1016426481 6:143941512-143941534 GCCATGGGCACTGTGAGCCTGGG - Exonic
1019300582 7:301580-301602 GCCTAGGGCCGTGTGATTTGAGG + Intergenic
1019469491 7:1211188-1211210 GCCGTGCTCCGTGTTATCCGAGG - Intergenic
1020115003 7:5471279-5471301 GCCCCGGCCCGTGTGTTCCGAGG - Intronic
1023699293 7:42876556-42876578 GCCACGATCTGTGTGATCCGGGG - Intergenic
1024248110 7:47485625-47485647 GCCATGGGCTGTGGCATCCCCGG + Intronic
1027996103 7:85427122-85427144 GCCATGGGCCTTGTGCTCTAAGG + Intergenic
1034214725 7:149396542-149396564 GCCATGGGCCATGAGTTCCATGG + Intergenic
1037980734 8:23251516-23251538 GCCATGGGCCCTGGGACCCTGGG + Intronic
1049254131 8:141604945-141604967 GCCCTTGGCTGTGTGTTCCGTGG + Intergenic
1049613811 8:143567754-143567776 GCCAGGGGCAGTGTGACCCCGGG + Intronic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1055514329 9:77020833-77020855 GCCATCCACCGTGTGCTCCGCGG + Exonic
1190708413 X:53048936-53048958 GCCATGGCCCGTGTGCTCCCAGG + Intergenic
1197766273 X:130061035-130061057 CTCATGGACCCTGTGATCCGGGG + Intergenic
1198293009 X:135257046-135257068 GCCATGGGCCTTGGGCTCTGAGG + Intronic
1201277536 Y:12312979-12313001 GGCATGGGCTATGTGCTCCGAGG + Intergenic