ID: 1049844165

View in Genome Browser
Species Human (GRCh38)
Location 8:144792110-144792132
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 55}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049844165_1049844172 -8 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844172 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 2
3: 9
4: 86
1049844165_1049844177 16 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 15
1049844165_1049844179 24 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844179 8:144792157-144792179 ATTAGCGCGGCCGGGCGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 59
1049844165_1049844169 -10 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844169 8:144792123-144792145 GGCCCATGGCGACGGGTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1049844165_1049844175 11 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844175 8:144792144-144792166 GGGGCGACTCACGATTAGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 11
1049844165_1049844170 -9 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 94
1049844165_1049844178 19 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844178 8:144792152-144792174 TCACGATTAGCGCGGCCGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 15
1049844165_1049844176 15 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844176 8:144792148-144792170 CGACTCACGATTAGCGCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 2
1049844165_1049844180 25 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844180 8:144792158-144792180 TTAGCGCGGCCGGGCGGCCCGGG 0: 1
1: 0
2: 1
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049844165 Original CRISPR GCCATGGGCCGTGTGATCCG TGG (reversed) Exonic