ID: 1049844166

View in Genome Browser
Species Human (GRCh38)
Location 8:144792115-144792137
Sequence GATCACACGGCCCATGGCGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 53}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049844157_1049844166 1 Left 1049844157 8:144792091-144792113 CCCGGCGCCCTTCCTCTGTCCAC 0: 1
1: 1
2: 0
3: 29
4: 287
Right 1049844166 8:144792115-144792137 GATCACACGGCCCATGGCGACGG 0: 1
1: 0
2: 0
3: 2
4: 53
1049844158_1049844166 0 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844166 8:144792115-144792137 GATCACACGGCCCATGGCGACGG 0: 1
1: 0
2: 0
3: 2
4: 53
1049844160_1049844166 -6 Left 1049844160 8:144792098-144792120 CCCTTCCTCTGTCCACGGATCAC 0: 1
1: 0
2: 5
3: 22
4: 191
Right 1049844166 8:144792115-144792137 GATCACACGGCCCATGGCGACGG 0: 1
1: 0
2: 0
3: 2
4: 53
1049844161_1049844166 -7 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844166 8:144792115-144792137 GATCACACGGCCCATGGCGACGG 0: 1
1: 0
2: 0
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049844166 Original CRISPR GATCACACGGCCCATGGCGA CGG Exonic