ID: 1049844169

View in Genome Browser
Species Human (GRCh38)
Location 8:144792123-144792145
Sequence GGCCCATGGCGACGGGTCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 78}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049844157_1049844169 9 Left 1049844157 8:144792091-144792113 CCCGGCGCCCTTCCTCTGTCCAC 0: 1
1: 1
2: 0
3: 29
4: 287
Right 1049844169 8:144792123-144792145 GGCCCATGGCGACGGGTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1049844161_1049844169 1 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844169 8:144792123-144792145 GGCCCATGGCGACGGGTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1049844158_1049844169 8 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844169 8:144792123-144792145 GGCCCATGGCGACGGGTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1049844165_1049844169 -10 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844169 8:144792123-144792145 GGCCCATGGCGACGGGTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1049844160_1049844169 2 Left 1049844160 8:144792098-144792120 CCCTTCCTCTGTCCACGGATCAC 0: 1
1: 0
2: 5
3: 22
4: 191
Right 1049844169 8:144792123-144792145 GGCCCATGGCGACGGGTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1049844163_1049844169 -3 Left 1049844163 8:144792103-144792125 CCTCTGTCCACGGATCACACGGC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1049844169 8:144792123-144792145 GGCCCATGGCGACGGGTCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049844169 Original CRISPR GGCCCATGGCGACGGGTCCT GGG Exonic
902393303 1:16118803-16118825 GGCCCATGAGGCCTGGTCCTGGG + Intergenic
903224436 1:21886828-21886850 GTCCCTTGGTGATGGGTCCTTGG - Intronic
903779894 1:25814471-25814493 GGACCATGGCGGCCAGTCCTGGG + Intronic
912515101 1:110212087-110212109 GGGCCATGGCGCCGGGTCTGGGG + Exonic
913191722 1:116418663-116418685 GGCGCTTCGCGGCGGGTCCTCGG + Intergenic
915553142 1:156646662-156646684 GGCCCCTGGCCCCTGGTCCTAGG + Intronic
916687792 1:167162831-167162853 GGCCCATGTTGGCTGGTCCTTGG + Intergenic
1062937796 10:1401058-1401080 GGGCCCTGGCGAGGGGTCCTGGG - Intronic
1067139911 10:43648485-43648507 GGCCCATGGCGTCGGGGCGTGGG - Intronic
1076797210 10:132804092-132804114 GGGCCATGGGGACGGGGCCGAGG - Intergenic
1077215570 11:1393981-1394003 GGGCCATGGAGATGGGTCCCTGG + Intronic
1077215601 11:1394074-1394096 GGGCCATGGAGATGGGTCCCTGG + Intronic
1077220419 11:1413215-1413237 GGCCCCTGGGGACGGCCCCTCGG + Intronic
1084162686 11:67358517-67358539 TGCCCATGGTGACAGGTCCACGG + Intronic
1084518089 11:69647104-69647126 GTCCCATGGTGACTGGTGCTAGG + Intronic
1084935170 11:72583108-72583130 AAGCCATGGGGACGGGTCCTGGG + Intronic
1088815442 11:113417583-113417605 GGCACATGGCCAAGGGTCCCAGG - Intronic
1094855494 12:34401047-34401069 GGCCCATGGCGACCAGCCCGGGG + Intergenic
1096156198 12:49342654-49342676 GGCCCAGGGCGACCCCTCCTAGG + Intergenic
1102240690 12:111322728-111322750 GGAACATGGCGGGGGGTCCTGGG + Intronic
1102422791 12:112817281-112817303 GACCCATGGGGATGGATCCTGGG - Intronic
1103415528 12:120739777-120739799 GGCCCAGTGCGACAGGCCCTTGG + Exonic
1105016016 12:132787380-132787402 GGGCCCTGGGGAGGGGTCCTGGG - Intronic
1105016049 12:132787463-132787485 GGCTCTTGGGGAGGGGTCCTGGG - Intronic
1105948436 13:25209239-25209261 GGCCCAGGGCAAGGGCTCCTTGG - Intergenic
1110195230 13:72781514-72781536 GGCCCAGGGAGGCGGGTCTTTGG - Intronic
1122970205 14:105149418-105149440 GGCCCAGGGCGGAGGGGCCTGGG - Intronic
1132055993 15:98650228-98650250 GGCGCTTGGAGACGTGTCCTGGG - Intronic
1132539804 16:503429-503451 GGCCCATGGAGACGCGACCTGGG + Intronic
1132685943 16:1162175-1162197 GGCCCAGGGCGAGGGGTCATGGG - Intronic
1133119280 16:3596265-3596287 GGCCGAAGGCGACGGGCCCCTGG + Exonic
1134638133 16:15808220-15808242 GGCCCTTGACGGTGGGTCCTCGG + Intronic
1142367193 16:89656917-89656939 GGCCCTGGGCAAGGGGTCCTGGG + Intronic
1143131740 17:4682769-4682791 GGGCCATGGGGAAGGGTCCAGGG + Intronic
1143140991 17:4741699-4741721 GGCCCAAGGAGCCAGGTCCTTGG - Exonic
1145241368 17:21242566-21242588 AGCCCATGGGGATGGGGCCTTGG + Exonic
1151196106 17:72432153-72432175 GGCCCAGGGTGCCGGGGCCTCGG - Intergenic
1151699549 17:75736052-75736074 GGCCCATGGAGCAGCGTCCTCGG - Exonic
1163862130 19:19748068-19748090 ATCCCATGGGGACGGGTCCCTGG + Intergenic
1168240494 19:55086658-55086680 GGCTCAGGGCGAGGGGTCCTGGG - Intronic
927591261 2:24360175-24360197 GCACGATGGGGACGGGTCCTCGG - Intronic
934056064 2:88252697-88252719 GGCCACTGGGGAAGGGTCCTGGG - Intergenic
938139215 2:128782702-128782724 GGCCACTGGCGAGGGTTCCTTGG - Intergenic
1171439457 20:25148552-25148574 GGCCCAGGACGCCGGGCCCTGGG - Intergenic
1171896501 20:30814232-30814254 GGCCCAGGGCCCAGGGTCCTGGG + Intergenic
1172986836 20:38998359-38998381 GGCCCATGTAGACTGGTCCAGGG - Intronic
1173318899 20:41969983-41970005 GGCCCATGGAGAGGGGCCCCAGG + Intergenic
1173803820 20:45911446-45911468 GGGCCATGGCGAGCGGGCCTGGG + Exonic
1176048490 20:63104617-63104639 GGCACATGGTGAGGGCTCCTGGG - Intergenic
1180069598 21:45429783-45429805 GGCCCATGTGCACGGGACCTGGG + Intronic
1182282712 22:29226446-29226468 GGGCCAGGGCCAAGGGTCCTAGG - Intronic
1182675874 22:32039473-32039495 GGCACATGTTGGCGGGTCCTTGG - Intergenic
1183098756 22:35570587-35570609 GGCCCCTGGCGAGGCCTCCTGGG + Intergenic
1184934244 22:47707288-47707310 GGCCCATGGGCACAGGCCCTGGG + Intergenic
950027867 3:9833168-9833190 AGCCCATGGCGATGTGTCATCGG + Exonic
950361961 3:12455936-12455958 GGCCCATGGCCTGGGGACCTCGG - Intergenic
951392982 3:22129961-22129983 GGCCCATGGCGACTGCTGCCTGG + Intronic
954362080 3:50127251-50127273 GGCCCATGGGAACCTGTCCTAGG - Intergenic
959268437 3:104172565-104172587 TGGCCATGGCCACAGGTCCTGGG - Intergenic
967105596 3:186252591-186252613 GGCCCATGGCTATGGGGCTTAGG + Intronic
970591391 4:17563362-17563384 GGCCCATGGCTAGGGGTCAAGGG - Intergenic
975497000 4:75046190-75046212 CGACCATGACTACGGGTCCTGGG + Exonic
985761685 5:1752188-1752210 TGCCCATGGGGAGAGGTCCTAGG - Intergenic
986212683 5:5689225-5689247 GGCACAAGGCAACGAGTCCTGGG - Intergenic
994107215 5:95961346-95961368 GGCCCCTGGCGGCGGGGCCGAGG - Intronic
995868254 5:116716227-116716249 GGCCCATGTTGGCAGGTCCTTGG - Intergenic
997522999 5:134535263-134535285 GGCCCAGGGTGACTGGTCCTGGG - Intronic
1001537594 5:172509052-172509074 AGCCCATGGCCACAGGTCCTTGG + Intergenic
1006615404 6:35322743-35322765 GGCCCATGGCGATCTGTCCCAGG + Intergenic
1007659857 6:43477494-43477516 GGGCCATGGGGGCGGGGCCTCGG - Intergenic
1007693284 6:43716423-43716445 GGCGCAGGGCCACGGGACCTGGG + Intergenic
1012586067 6:100923945-100923967 GGCCCATGGAGACTGGAGCTGGG + Intergenic
1015736991 6:136411593-136411615 GGGCCATGGACACGGGGCCTGGG + Intronic
1020252924 7:6483892-6483914 GGCCGAGGTCGGCGGGTCCTCGG + Intronic
1024985873 7:55192630-55192652 GGGCCTGGGGGACGGGTCCTGGG + Intronic
1029694853 7:102205847-102205869 GACCCATGGCCACGGCTCCCAGG + Intronic
1034343535 7:150372296-150372318 GGCCCCTGGCGGCGGCTCCTGGG - Exonic
1034445999 7:151114723-151114745 GGCCCATGGCGAGGGGCACGGGG - Intronic
1036649233 8:10631793-10631815 GACCAAGGGCGATGGGTCCTGGG + Intronic
1049818880 8:144622186-144622208 GGCCCAAGGTGAGGGGTCCCGGG + Intergenic
1049844169 8:144792123-144792145 GGCCCATGGCGACGGGTCCTGGG + Exonic
1056869943 9:90268006-90268028 GGCCCAAGGAGATGGGTCCAAGG - Intergenic
1057310349 9:93939075-93939097 GCCCCATGGGGACAGGACCTGGG + Intergenic
1059345124 9:113623201-113623223 GGCCCATGGGGTCGGCTCCCTGG - Intergenic
1060481913 9:124021359-124021381 GGCCCACGGCGAGGGGTGCAGGG - Intronic
1062390524 9:136331943-136331965 CCACCATGGCCACGGGTCCTGGG - Intronic
1201065068 Y:10089306-10089328 GGCCCAGGGCCCAGGGTCCTGGG + Intergenic