ID: 1049844170

View in Genome Browser
Species Human (GRCh38)
Location 8:144792124-144792146
Sequence GCCCATGGCGACGGGTCCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 94}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049844158_1049844170 9 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 94
1049844160_1049844170 3 Left 1049844160 8:144792098-144792120 CCCTTCCTCTGTCCACGGATCAC 0: 1
1: 0
2: 5
3: 22
4: 191
Right 1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 94
1049844163_1049844170 -2 Left 1049844163 8:144792103-144792125 CCTCTGTCCACGGATCACACGGC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 94
1049844157_1049844170 10 Left 1049844157 8:144792091-144792113 CCCGGCGCCCTTCCTCTGTCCAC 0: 1
1: 1
2: 0
3: 29
4: 287
Right 1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 94
1049844165_1049844170 -9 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 94
1049844161_1049844170 2 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG 0: 1
1: 0
2: 0
3: 11
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049844170 Original CRISPR GCCCATGGCGACGGGTCCTG GGG Exonic
900132351 1:1092453-1092475 GGCCATGGTAACAGGTCCTGTGG - Intronic
900989539 1:6091995-6092017 GCCCTTGGGGTGGGGTCCTGGGG - Intronic
902393304 1:16118804-16118826 GCCCATGAGGCCTGGTCCTGGGG + Intergenic
902672584 1:17985094-17985116 GCCCCTGGGGACGGGACCTGTGG + Intergenic
905871523 1:41407082-41407104 GCCAATGCCGACGGAGCCTGAGG - Intergenic
910550331 1:88467344-88467366 GCCCACGGCGCCGGGGGCTGGGG - Intergenic
910842337 1:91572342-91572364 GCCCTTGGCTCCGAGTCCTGAGG + Intergenic
912515102 1:110212088-110212110 GGCCATGGCGCCGGGTCTGGGGG + Exonic
914255829 1:145960855-145960877 GCCCATGGGGGCGGGTCCTCAGG + Exonic
917929383 1:179813197-179813219 GCCTCTGGCTACGGGTCCCGGGG - Intronic
919751205 1:201039424-201039446 GCCCATGGGCAGGGTTCCTGGGG + Intergenic
920665425 1:207959576-207959598 CCCCAAGCGGACGGGTCCTGGGG + Intergenic
1062894304 10:1091127-1091149 GCACATGGTGACGGGAGCTGTGG - Intronic
1062909372 10:1202659-1202681 GCCCAGGGCTCCGGGTACTGTGG + Intronic
1063125086 10:3130001-3130023 TCCCAAGGGGACGGGCCCTGAGG - Intronic
1063352806 10:5372275-5372297 GCCCATGGCCACTGTCCCTGAGG - Intronic
1063639765 10:7818331-7818353 GCCCAGGGCGGCAGGTGCTGGGG - Intergenic
1064118812 10:12601954-12601976 GCCCAGGGCAAGGGATCCTGTGG + Intronic
1069899777 10:71700790-71700812 GCCCCTGTCCATGGGTCCTGGGG - Intronic
1076794397 10:132791604-132791626 GCCCCTGCCGAGGGGTCCTGTGG - Intergenic
1076922181 10:133459824-133459846 TCCCGTGGCGACGGGCCATGGGG - Intergenic
1077556808 11:3229944-3229966 GCTCACGGGGACAGGTCCTGCGG + Intronic
1102240691 12:111322729-111322751 GAACATGGCGGGGGGTCCTGGGG + Intronic
1105016048 12:132787462-132787484 GCTCTTGGGGAGGGGTCCTGGGG - Intronic
1113885280 13:113655571-113655593 GCCCATGGCCACGGGGACGGTGG - Intronic
1114672764 14:24420622-24420644 GCCCATGGTGCAGGGGCCTGGGG + Intergenic
1118600116 14:67466149-67466171 CCAGATGGCGAAGGGTCCTGGGG - Intronic
1121515325 14:94545764-94545786 TTCCATGGCAACGGGTGCTGTGG + Intergenic
1122970204 14:105149417-105149439 GCCCAGGGCGGAGGGGCCTGGGG - Intronic
1130965775 15:88696452-88696474 TCCCATAGCGACTGGGCCTGAGG - Intergenic
1132055992 15:98650227-98650249 GCGCTTGGAGACGTGTCCTGGGG - Intronic
1132539805 16:503430-503452 GCCCATGGAGACGCGACCTGGGG + Intronic
1132685942 16:1162174-1162196 GCCCAGGGCGAGGGGTCATGGGG - Intronic
1133046610 16:3091804-3091826 GGCCATGGTGAGGGGCCCTGGGG + Exonic
1135206833 16:20491924-20491946 CCCCAGGGCGACGGGCTCTGGGG - Intergenic
1135212052 16:20531708-20531730 CCCCAGGGCGACGGGCTCTGGGG + Intergenic
1135606989 16:23834039-23834061 CCTCATGGCGCCGGGGCCTGGGG - Intergenic
1137270979 16:46901995-46902017 GCCCATGGCCACGGGGTCTTTGG - Intronic
1140409795 16:74734690-74734712 GCCCAGGAGGAGGGGTCCTGGGG - Intronic
1141171177 16:81692705-81692727 GCCTATGGGGACGGGGACTGAGG - Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1152822332 17:82443758-82443780 AGCCAAGGCCACGGGTCCTGTGG + Exonic
1153597954 18:6748071-6748093 GCTCATGGCCACAGGTGCTGTGG + Intronic
1156459319 18:37312843-37312865 GTCCTTGGCCAAGGGTCCTGGGG - Intronic
1160538362 18:79607300-79607322 CCCCATGGAGACGGGGCCTTCGG - Intergenic
1163462692 19:17448457-17448479 GGCCATGGCGGGGGTTCCTGCGG + Exonic
1165247457 19:34505457-34505479 GCCCAGGGCTACCAGTCCTGAGG - Exonic
1165928492 19:39342105-39342127 GCCCAGGGCAACGGGCCCGGCGG - Intronic
1167461107 19:49625212-49625234 TCCCAGGGCGATGGGTGCTGTGG - Intronic
1168240493 19:55086657-55086679 GCTCAGGGCGAGGGGTCCTGGGG - Intronic
928449448 2:31365528-31365550 GCACAGGGCGGCCGGTCCTGGGG + Exonic
934056063 2:88252696-88252718 GCCACTGGGGAAGGGTCCTGGGG - Intergenic
940057528 2:149528643-149528665 GCCCATGGGGAAGGGCCCAGCGG - Intergenic
941360618 2:164546888-164546910 ACCCATGGCCAGGGGACCTGTGG - Intronic
943674931 2:190707284-190707306 GCCCATGGTTGCTGGTCCTGGGG - Intergenic
946416673 2:219543482-219543504 GCCCACGGCCACGGGCCCTGCGG + Exonic
948037695 2:234872633-234872655 GCTCAAGGTGACAGGTCCTGAGG - Intergenic
1171139528 20:22728979-22729001 GCCCATGGCCAAGGGACCAGTGG - Intergenic
1171439456 20:25148551-25148573 GCCCAGGACGCCGGGCCCTGGGG - Intergenic
1171896502 20:30814233-30814255 GCCCAGGGCCCAGGGTCCTGGGG + Intergenic
1171942489 20:31344933-31344955 GCCCATAGGGAGGGATCCTGAGG - Intergenic
1173803821 20:45911447-45911469 GGCCATGGCGAGCGGGCCTGGGG + Exonic
1174945453 20:54980305-54980327 GGCCATGGCAATGGGTCCTGTGG + Intergenic
1175161579 20:57011782-57011804 GCCCAGGGGGACTGGCCCTGAGG - Intergenic
1176048489 20:63104616-63104638 GCACATGGTGAGGGCTCCTGGGG - Intergenic
1176383198 21:6123976-6123998 GCCACTGGGGAAGGGTCCTGAGG - Intergenic
1178215444 21:30592500-30592522 GGCCATGGCTATGGGTGCTGTGG + Exonic
1178215986 21:30598819-30598841 GACCATGGCTATGGGTGCTGTGG - Exonic
1179740269 21:43414263-43414285 GCCACTGGGGAAGGGTCCTGAGG + Intergenic
1183098757 22:35570588-35570610 GCCCCTGGCGAGGCCTCCTGGGG + Intergenic
953588461 3:44228029-44228051 GCTCATGGCTACTGGTTCTGTGG - Intergenic
954663666 3:52239148-52239170 GCCGCTGGGGGCGGGTCCTGCGG - Exonic
961166509 3:124767169-124767191 GGCAATGGCAATGGGTCCTGGGG + Intronic
962752320 3:138442557-138442579 GCCCATGGACAAGAGTCCTGGGG - Intronic
968916817 4:3500254-3500276 GTCCACAGCCACGGGTCCTGGGG - Intronic
969519342 4:7666675-7666697 GCCCATGGCCACAGTTCATGGGG + Intronic
969606617 4:8205233-8205255 CCCCATGGGGAGGGGTCCTGTGG + Exonic
969608983 4:8216654-8216676 GTCCATGGAGAAGGGCCCTGGGG + Intronic
973191504 4:47390941-47390963 GCCGAGGGGGACGGGTCATGAGG + Intronic
975497001 4:75046191-75046213 GACCATGACTACGGGTCCTGGGG + Exonic
986233603 5:5887367-5887389 GCCCTCGAGGACGGGTCCTGTGG + Intergenic
992813021 5:80408225-80408247 GCCCAGGTCGGCGGGTCCAGCGG - Intronic
1001518196 5:172372076-172372098 GCCCCTGGGTACGGGCCCTGTGG - Intronic
1001677789 5:173532878-173532900 GACCATGGCTGCGGGTACTGAGG + Intergenic
1006756829 6:36423474-36423496 GCACATGGCGACGCGGCCGGCGG + Intronic
1007359580 6:41345516-41345538 GCCCTTGGTGGCGGGTGCTGGGG - Intronic
1012586068 6:100923946-100923968 GCCCATGGAGACTGGAGCTGGGG + Intergenic
1015736992 6:136411594-136411616 GGCCATGGACACGGGGCCTGGGG + Intronic
1018457971 6:163969765-163969787 GCCCAAGGCCAGGGGTCCCGAGG - Intergenic
1018633575 6:165841344-165841366 GCCCATGGAGATCGGCCCTGTGG + Intronic
1019607804 7:1918828-1918850 CCCCAGGGCGACTGGTGCTGTGG + Intronic
1024985874 7:55192631-55192653 GGCCTGGGGGACGGGTCCTGGGG + Intronic
1026930145 7:74219415-74219437 GCCCCTGGAGACGGGTCAGGAGG - Intronic
1029027935 7:97437460-97437482 GCCTGTGGCAACAGGTCCTGAGG - Intergenic
1032423810 7:131804065-131804087 GCCCATGGCAACCGATTCTGAGG + Intergenic
1034383941 7:150722392-150722414 GGCTATGGTGAGGGGTCCTGAGG + Exonic
1035096442 7:156360008-156360030 GTCCTTGGCGTGGGGTCCTGGGG + Intergenic
1036649234 8:10631794-10631816 ACCAAGGGCGATGGGTCCTGGGG + Intronic
1041059374 8:54021886-54021908 GCCCGGGGCGTCGGGTCCCGCGG - Intronic
1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG + Exonic
1059592489 9:115677241-115677263 GATCATGGGGATGGGTCCTGAGG - Intergenic
1062390523 9:136331942-136331964 CACCATGGCCACGGGTCCTGGGG - Intronic
1062418496 9:136466503-136466525 GCACATGGGGACGGGGCCTCCGG - Intronic
1186515995 X:10166499-10166521 GCACATGGCTCTGGGTCCTGAGG + Intronic
1191930409 X:66365693-66365715 GCCCATGCCAACAGGGCCTGGGG - Intergenic
1200793978 Y:7323886-7323908 GCCCTTGGTGAAGGGGCCTGAGG + Intergenic