ID: 1049844171

View in Genome Browser
Species Human (GRCh38)
Location 8:144792125-144792147
Sequence CCCCCAGGACCCGTCGCCAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 83}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049844171_1049844183 27 Left 1049844171 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 1
3: 4
4: 83
Right 1049844183 8:144792175-144792197 CCCGGGTACCCCCGCCAGCCCGG 0: 1
1: 0
2: 2
3: 18
4: 172
1049844171_1049844176 0 Left 1049844171 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 1
3: 4
4: 83
Right 1049844176 8:144792148-144792170 CGACTCACGATTAGCGCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 2
1049844171_1049844177 1 Left 1049844171 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 1
3: 4
4: 83
Right 1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 15
1049844171_1049844180 10 Left 1049844171 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 1
3: 4
4: 83
Right 1049844180 8:144792158-144792180 TTAGCGCGGCCGGGCGGCCCGGG 0: 1
1: 0
2: 1
3: 7
4: 92
1049844171_1049844175 -4 Left 1049844171 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 1
3: 4
4: 83
Right 1049844175 8:144792144-144792166 GGGGCGACTCACGATTAGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 11
1049844171_1049844178 4 Left 1049844171 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 1
3: 4
4: 83
Right 1049844178 8:144792152-144792174 TCACGATTAGCGCGGCCGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 15
1049844171_1049844179 9 Left 1049844171 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 1
3: 4
4: 83
Right 1049844179 8:144792157-144792179 ATTAGCGCGGCCGGGCGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049844171 Original CRISPR CCCCCAGGACCCGTCGCCAT GGG (reversed) Exonic
901696750 1:11013137-11013159 CCGCCAGGACCTGTCGCCGCGGG + Intronic
902393305 1:16118805-16118827 CCCCCAGGACCAGGCCTCATGGG - Intergenic
904333594 1:29783406-29783428 ACCCCAGGAGCTGTAGCCATAGG + Intergenic
905365521 1:37449120-37449142 CCCCCAGGACCCATGCCCAGGGG - Intergenic
914255830 1:145960856-145960878 CCCTGAGGACCCGCCCCCATGGG - Exonic
915270166 1:154748031-154748053 CCCCCAGCACCAGCCTCCATTGG + Intronic
915322229 1:155062295-155062317 CCCCCAGGGCCGGTGCCCATCGG + Exonic
917929382 1:179813196-179813218 TCCCCGGGACCCGTAGCCAGAGG + Intronic
920293119 1:204938113-204938135 CTCCCACGAGCTGTCGCCATCGG - Intronic
920665426 1:207959577-207959599 GCCCCAGGACCCGTCCGCTTGGG - Intergenic
924801565 1:247332153-247332175 CCCCCAGGACACGCGGCCAGTGG + Intergenic
1067139910 10:43648483-43648505 CTCCCACGCCCCGACGCCATGGG + Intronic
1069664636 10:70146300-70146322 CCCCCGGGACCCGCGGCCGTTGG + Exonic
1076730363 10:132436134-132436156 CCCCCAGGCCCCTTCTCCACTGG + Intergenic
1076730415 10:132436310-132436332 CCCCCAGGCCCCTTCTCCACTGG + Intergenic
1076730442 10:132436395-132436417 CCCCCAGGCCCCTTCTCCACTGG + Intergenic
1076730469 10:132436483-132436505 CCCCCAGGTCCCTTCTCCACTGG + Intergenic
1076922180 10:133459823-133459845 CCCCCATGGCCCGTCGCCACGGG + Intergenic
1077047677 11:553573-553595 CCCCCAGCACCCGCCTCCACCGG - Intronic
1077976468 11:7252591-7252613 CCCCCAGGAGCCTTGGCGATGGG - Intronic
1079237021 11:18698582-18698604 CCCCCAGGCCCCGCCCCCTTGGG - Intronic
1084271519 11:68031738-68031760 CCCCCAGGAACCGTGCCCAGGGG - Intronic
1084410851 11:69005218-69005240 CCTCCAAGACCCTTCGCCTTGGG - Exonic
1088907892 11:114168783-114168805 CCCCCAGGACCCTTGGGCACAGG - Intronic
1105024038 12:132836967-132836989 CCCCCAGCACCTGTCACTATCGG - Intronic
1121546556 14:94767786-94767808 CCCCGTGGACCCGCCGCCTTAGG + Intergenic
1122289210 14:100670745-100670767 CCCCCAGGGCCCATCTCCACTGG + Intergenic
1122970203 14:105149416-105149438 CCCCCAGGCCCCTCCGCCCTGGG + Intronic
1122987089 14:105217466-105217488 GCTCCAGGACCCGAAGCCATGGG + Intronic
1125433736 15:39624737-39624759 CCCCCAGGACCCTTTGTCCTTGG - Intronic
1128127845 15:65205979-65206001 CCCCCAGGCCCAGACGCCAGTGG - Intronic
1130053199 15:80501190-80501212 ACCCCAGCACCCTTGGCCATAGG + Intronic
1130965774 15:88696451-88696473 CCCTCAGGCCCAGTCGCTATGGG + Intergenic
1131182367 15:90249487-90249509 CCCCCAGGACGCTTCTCCAATGG + Intergenic
1132532296 16:458416-458438 CCCCCAGGCCCTGTGGGCATCGG - Intronic
1132532311 16:458455-458477 CCCCCAGGCCCTGTGGGCATCGG - Intronic
1132532326 16:458494-458516 CCCCCAGGCCCTGTGGGCATCGG - Intronic
1132532341 16:458533-458555 CCCCCAGGCCCTGTGGGCATCGG - Intronic
1132532356 16:458572-458594 CCCCCAGGCCCTGTGGGCATCGG - Intronic
1132539806 16:503431-503453 GCCCCAGGTCGCGTCTCCATGGG - Intronic
1132685941 16:1162173-1162195 GCCCCATGACCCCTCGCCCTGGG + Intronic
1134413991 16:14028338-14028360 CCCCCAGGTCCCATGGCCTTAGG + Intergenic
1135206832 16:20491923-20491945 TCCCCAGAGCCCGTCGCCCTGGG + Intergenic
1135212053 16:20531709-20531731 TCCCCAGAGCCCGTCGCCCTGGG - Intergenic
1138576796 16:57912496-57912518 CCTCCAGGCCCCGTCTCCACTGG - Intronic
1146469706 17:33114299-33114321 CCCCAAGAACACGTCTCCATGGG - Intronic
1146946548 17:36877503-36877525 CCCCCAGGGCCCCTCCCCAGTGG - Intergenic
1152817972 17:82419757-82419779 CCCCAAGGAGACTTCGCCATAGG + Exonic
1157552967 18:48594153-48594175 CCCCCAGGACCCGCCGGAAAAGG - Intronic
1160538361 18:79607299-79607321 CCCGAAGGCCCCGTCTCCATGGG + Intergenic
1160895392 19:1399921-1399943 CCTCCAGGACCCGGCCCCCTGGG + Exonic
1161126459 19:2560626-2560648 CCCCCAGGCCCTGTGGACATCGG - Intronic
1167461106 19:49625211-49625233 CCCACAGCACCCATCGCCCTGGG + Intronic
1167650372 19:50725394-50725416 CCACCAGGAGCCGTCGTCAGAGG - Exonic
934056062 2:88252695-88252717 CCCCCAGGACCCTTCCCCAGTGG + Intergenic
938289800 2:130143141-130143163 CCCCCAGAACCTGTCCCCACTGG + Intronic
941360617 2:164546887-164546909 CCCACAGGTCCCCTGGCCATGGG + Intronic
943674930 2:190707283-190707305 CCCCCAGGACCAGCAACCATGGG + Intergenic
946416674 2:219543483-219543505 CCCGCAGGGCCCGTGGCCGTGGG - Exonic
948710962 2:239825301-239825323 CCCCCAGGTCCCCTCCCCACAGG - Intergenic
1171439455 20:25148550-25148572 CCCCCAGGGCCCGGCGTCCTGGG + Intergenic
1178927051 21:36785045-36785067 ACCCCAGGTACCGTCGCCTTCGG + Intronic
1184713645 22:46268103-46268125 CCCCCAGGACCCGGGGCCCGAGG - Intronic
962752319 3:138442556-138442578 CCCCCAGGACTCTTGTCCATGGG + Intronic
965956500 3:174377226-174377248 TGAGCAGGACCCGTCGCCATGGG + Intergenic
969575442 4:8033695-8033717 ACCCCAGGACCTGTCCCCAGAGG - Intronic
969606618 4:8205234-8205256 CCCACAGGACCCCTCCCCATGGG - Exonic
982157215 4:152535275-152535297 CCCCCCGGCCCCGCCGCCCTCGG + Exonic
985305653 4:188536565-188536587 CCCCCAGGACTGTTAGCCATTGG + Intergenic
985512936 5:322174-322196 CCCCCCGGACCTGGCGCCCTCGG - Intronic
986283609 5:6344055-6344077 CACCCAGGGGCCGTCGCCTTGGG + Intergenic
989279348 5:39622573-39622595 CCCCCAGAACCCGCCACCCTGGG - Intergenic
1001043954 5:168356839-168356861 CCACCAGGAACCGTCTCCATGGG - Intronic
1001537595 5:172509054-172509076 CACCAAGGACCTGTGGCCATGGG - Intergenic
1003961713 6:11215066-11215088 CACACAGGACCCGTGGCAATGGG - Intronic
1007629045 6:43262720-43262742 CCCCAAGGACCCCACGCCAGCGG - Intronic
1018039274 6:159907387-159907409 CCCCAAGTACCAGTCGGCATTGG + Exonic
1024333175 7:48177354-48177376 CCCCAAGGACCTCTAGCCATAGG - Intronic
1029027934 7:97437459-97437481 CCCTCAGGACCTGTTGCCACAGG + Intergenic
1034174776 7:149091334-149091356 CCACCAGGTCCGGTCGCCGTGGG + Intergenic
1035315105 7:157992725-157992747 CCCCCAGGCACCGTGGCCACAGG + Intronic
1036649235 8:10631795-10631817 CCCCCAGGACCCATCGCCCTTGG - Intronic
1036661585 8:10712715-10712737 CCACCAGGACCTGTCCCAATGGG + Intergenic
1037876842 8:22552581-22552603 CCCCCACGACCCGTAGTCAGAGG - Intronic
1044820591 8:96153485-96153507 CCCCCAGGTCCCGGCCCCAGGGG - Intronic
1048005900 8:130419174-130419196 CCCCAAGGACACGGCGCTATGGG + Intronic
1049844171 8:144792125-144792147 CCCCCAGGACCCGTCGCCATGGG - Exonic
1052861805 9:33442196-33442218 CCCCCAGGACCGGCCAGCATTGG - Exonic
1060395783 9:123315449-123315471 CTCCCAGGACCTGTTGCCACCGG + Intergenic