ID: 1049844172

View in Genome Browser
Species Human (GRCh38)
Location 8:144792125-144792147
Sequence CCCATGGCGACGGGTCCTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 86}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049844163_1049844172 -1 Left 1049844163 8:144792103-144792125 CCTCTGTCCACGGATCACACGGC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1049844172 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 2
3: 9
4: 86
1049844160_1049844172 4 Left 1049844160 8:144792098-144792120 CCCTTCCTCTGTCCACGGATCAC 0: 1
1: 0
2: 5
3: 22
4: 191
Right 1049844172 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 2
3: 9
4: 86
1049844165_1049844172 -8 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844172 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 2
3: 9
4: 86
1049844157_1049844172 11 Left 1049844157 8:144792091-144792113 CCCGGCGCCCTTCCTCTGTCCAC 0: 1
1: 1
2: 0
3: 29
4: 287
Right 1049844172 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 2
3: 9
4: 86
1049844158_1049844172 10 Left 1049844158 8:144792092-144792114 CCGGCGCCCTTCCTCTGTCCACG 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1049844172 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 2
3: 9
4: 86
1049844161_1049844172 3 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844172 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 2
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049844172 Original CRISPR CCCATGGCGACGGGTCCTGG GGG Exonic
901207455 1:7505220-7505242 CCCATGGGCAAAGGTCCTGGAGG - Intronic
901696749 1:11013137-11013159 CCCGCGGCGACAGGTCCTGGCGG - Intronic
902393306 1:16118805-16118827 CCCATGAGGCCTGGTCCTGGGGG + Intergenic
905365522 1:37449120-37449142 CCCCTGGGCATGGGTCCTGGGGG + Intergenic
905369256 1:37474575-37474597 TCCATGGGGCCGAGTCCTGGGGG - Exonic
908687479 1:66738270-66738292 ACCATGGAGAAGGGTCCTGAAGG - Intronic
914255831 1:145960856-145960878 CCCATGGGGGCGGGTCCTCAGGG + Exonic
924004837 1:239598064-239598086 CCCAGGGCCAGGGGTCCTGAAGG + Intronic
924569473 1:245225281-245225303 ACCAAGGAGAAGGGTCCTGGGGG + Intronic
1071510783 10:86261309-86261331 GCCATGCCGGCAGGTCCTGGGGG - Intronic
1072421043 10:95290873-95290895 CCCACGGCCCCGGGCCCTGGAGG + Exonic
1072439043 10:95437924-95437946 CCCAGGGCGACAGGGCCTGCCGG - Intronic
1073137756 10:101229141-101229163 CTCCTGGCCCCGGGTCCTGGCGG + Exonic
1076922179 10:133459823-133459845 CCCGTGGCGACGGGCCATGGGGG - Intergenic
1077265630 11:1648077-1648099 CGCATGGAGACGCGGCCTGGAGG + Intergenic
1077976469 11:7252591-7252613 CCCATCGCCAAGGCTCCTGGGGG + Intronic
1079099497 11:17532104-17532126 TCCATGGGGACAGGTCATGGAGG - Intronic
1079237022 11:18698582-18698604 CCCAAGGGGGCGGGGCCTGGGGG + Intronic
1083852830 11:65377948-65377970 CTGATGGCGACGGGGGCTGGCGG + Intronic
1084271520 11:68031738-68031760 CCCCTGGGCACGGTTCCTGGGGG + Intronic
1084410852 11:69005218-69005240 CCCAAGGCGAAGGGTCTTGGAGG + Exonic
1085529072 11:77181128-77181150 CCCATGGAGCAGGCTCCTGGAGG + Intronic
1088577525 11:111285976-111285998 CCCAAGGGGAAGGGTCATGGAGG - Exonic
1096780792 12:53991002-53991024 CCCATGGCAATGGGCCCGGGAGG - Intronic
1097266629 12:57749352-57749374 CCCATGGGGATGGGAACTGGAGG - Intronic
1105021998 12:132822987-132823009 CCCAAGGCCACGGCTCCTGCCGG + Intronic
1114265118 14:21069340-21069362 CCCATGGCCACGAGCCCTAGCGG + Intronic
1122970202 14:105149416-105149438 CCCAGGGCGGAGGGGCCTGGGGG - Intronic
1125733463 15:41907385-41907407 CCCAGGGAGACTGCTCCTGGAGG + Intronic
1125832223 15:42725143-42725165 CCCCTGGCCACTGGGCCTGGTGG + Exonic
1130965773 15:88696451-88696473 CCCATAGCGACTGGGCCTGAGGG - Intergenic
1138576797 16:57912496-57912518 CCAGTGGAGACGGGGCCTGGAGG + Intronic
1139370086 16:66461665-66461687 GCCATGGCCAGGGGTCATGGGGG + Intronic
1146469707 17:33114299-33114321 CCCATGGAGACGTGTTCTTGGGG + Intronic
1147313516 17:39608036-39608058 CAGATGGCGGCGGGTCCCGGGGG - Intronic
1150579294 17:66457574-66457596 CCCATGTGGAAGGGACCTGGTGG + Intronic
1150586364 17:66522140-66522162 TCCTGGGCGACGGGTCCTGCAGG + Intronic
1152528279 17:80902151-80902173 CCCAGGGCAACGAGGCCTGGTGG - Intronic
1152822333 17:82443759-82443781 GCCAAGGCCACGGGTCCTGTGGG + Exonic
1158728105 18:59993218-59993240 CCCATGTGGAAGGGACCTGGTGG + Intergenic
1160538360 18:79607299-79607321 CCCATGGAGACGGGGCCTTCGGG - Intergenic
1160700068 19:501861-501883 CTCAGGGCGGCGAGTCCTGGTGG - Exonic
1160895391 19:1399921-1399943 CCCAGGGGGCCGGGTCCTGGAGG - Exonic
1160952337 19:1673779-1673801 CCCATAGCGACGGGAGCTGCTGG - Intergenic
1161004809 19:1929901-1929923 CCCATGGCTACTGCCCCTGGTGG + Intergenic
1167299382 19:48670390-48670412 CCCATCGAGACTGGCCCTGGCGG - Exonic
1167461105 19:49625211-49625233 CCCAGGGCGATGGGTGCTGTGGG - Intronic
1167650373 19:50725394-50725416 CCTCTGACGACGGCTCCTGGTGG + Exonic
928449449 2:31365529-31365551 CACAGGGCGGCCGGTCCTGGGGG + Exonic
934056061 2:88252695-88252717 CCACTGGGGAAGGGTCCTGGGGG - Intergenic
937979798 2:127608320-127608342 CCCCTGGGGACCTGTCCTGGTGG + Intronic
938502262 2:131836236-131836258 CCCGTGGACACGGCTCCTGGAGG + Intergenic
941360616 2:164546887-164546909 CCCATGGCCAGGGGACCTGTGGG - Intronic
943674929 2:190707283-190707305 CCCATGGTTGCTGGTCCTGGGGG - Intergenic
946252901 2:218424217-218424239 CCCAGGCCTAGGGGTCCTGGTGG + Intronic
946416675 2:219543483-219543505 CCCACGGCCACGGGCCCTGCGGG + Exonic
1171439454 20:25148550-25148572 CCCAGGACGCCGGGCCCTGGGGG - Intergenic
1172409179 20:34709554-34709576 CCCAGGGAGACGGATCTTGGAGG + Intronic
1173803822 20:45911448-45911470 GCCATGGCGAGCGGGCCTGGGGG + Exonic
1175883904 20:62277369-62277391 CCCCTGGGGAAGGGTGCTGGCGG - Intronic
1176048488 20:63104615-63104637 CACATGGTGAGGGCTCCTGGGGG - Intergenic
1182502222 22:30755891-30755913 TCCATGGCCAAGGGCCCTGGTGG - Intronic
1182511357 22:30822572-30822594 TACATGGCGCCGGGTCCCGGGGG - Intronic
1182759123 22:32707790-32707812 CCCATGGGGAAGGGGCTTGGAGG + Intronic
1183105395 22:35611674-35611696 CAGATGACGAAGGGTCCTGGTGG + Intronic
1184671344 22:46013664-46013686 CCCAGGGCTGCAGGTCCTGGCGG - Intergenic
1185269316 22:49921648-49921670 GACAGGGCGACGGGTCCTGCCGG + Exonic
953131645 3:40145188-40145210 CACATGGGTACGGGTGCTGGTGG - Intronic
954678947 3:52331105-52331127 CCCATGGCGGGGGGCACTGGTGG + Intronic
955514145 3:59709915-59709937 CTCATGGCCACGGGACCTGGAGG - Intergenic
962752318 3:138442556-138442578 CCCATGGACAAGAGTCCTGGGGG - Intronic
969606619 4:8205234-8205256 CCCATGGGGAGGGGTCCTGTGGG + Exonic
969608984 4:8216655-8216677 TCCATGGAGAAGGGCCCTGGGGG + Intronic
975581580 4:75911613-75911635 CTCATGGTCACAGGTCCTGGTGG + Intergenic
985493786 5:193436-193458 CACATGGCAGTGGGTCCTGGTGG + Intronic
989279349 5:39622573-39622595 CCCAGGGTGGCGGGTTCTGGGGG + Intergenic
998135857 5:139674171-139674193 CCCAGGGAGACTGGTCTTGGAGG - Intronic
1001043955 5:168356839-168356861 CCCATGGAGACGGTTCCTGGTGG + Intronic
1001081268 5:168669369-168669391 CCCATGGCGCTGGGTGTTGGCGG - Intronic
1003502722 6:6715579-6715601 GCCATGGGGCCTGGTCCTGGGGG - Intergenic
1008381876 6:50845975-50845997 CCCGGGGCGCCGGCTCCTGGAGG + Exonic
1019133856 6:169896360-169896382 CCCATGGCCTAGGCTCCTGGTGG - Intergenic
1019329442 7:455405-455427 CCCATGGCCTCGGGTTCAGGTGG - Intergenic
1022160096 7:27701835-27701857 CACATGGCGGCGGGGCATGGTGG - Intergenic
1023619515 7:42055515-42055537 CCCAAGGCCACTGTTCCTGGTGG + Intronic
1034174775 7:149091334-149091356 CCCACGGCGACCGGACCTGGTGG - Intergenic
1034672195 7:152867278-152867300 CGCGTGGCGAAGGCTCCTGGGGG + Intergenic
1036649236 8:10631795-10631817 CCAAGGGCGATGGGTCCTGGGGG + Intronic
1036661584 8:10712715-10712737 CCCATTGGGACAGGTCCTGGTGG - Intergenic
1037561215 8:20076153-20076175 CCCTTGGGGACAGGTACTGGAGG - Intergenic
1044820592 8:96153485-96153507 CCCCTGGGGCCGGGACCTGGGGG + Intronic
1048005899 8:130419174-130419196 CCCATAGCGCCGTGTCCTTGGGG - Intronic
1049844172 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG + Exonic
1061403811 9:130382827-130382849 CCCACGGCTGCAGGTCCTGGAGG + Intronic
1062390522 9:136331941-136331963 ACCATGGCCACGGGTCCTGGGGG - Intronic
1062506638 9:136880906-136880928 ACCGTGGTGACTGGTCCTGGCGG + Intronic
1195595548 X:106684002-106684024 CCCATGGTGACCATTCCTGGCGG - Intergenic
1200060431 X:153481439-153481461 CCCATGGCCTGGGGTCTTGGAGG - Intronic