ID: 1049844173

View in Genome Browser
Species Human (GRCh38)
Location 8:144792126-144792148
Sequence GCCCCCAGGACCCGTCGCCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 144}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049844173_1049844179 8 Left 1049844173 8:144792126-144792148 CCATGGCGACGGGTCCTGGGGGC 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1049844179 8:144792157-144792179 ATTAGCGCGGCCGGGCGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 59
1049844173_1049844178 3 Left 1049844173 8:144792126-144792148 CCATGGCGACGGGTCCTGGGGGC 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1049844178 8:144792152-144792174 TCACGATTAGCGCGGCCGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 15
1049844173_1049844180 9 Left 1049844173 8:144792126-144792148 CCATGGCGACGGGTCCTGGGGGC 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1049844180 8:144792158-144792180 TTAGCGCGGCCGGGCGGCCCGGG 0: 1
1: 0
2: 1
3: 7
4: 92
1049844173_1049844176 -1 Left 1049844173 8:144792126-144792148 CCATGGCGACGGGTCCTGGGGGC 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1049844176 8:144792148-144792170 CGACTCACGATTAGCGCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 2
1049844173_1049844177 0 Left 1049844173 8:144792126-144792148 CCATGGCGACGGGTCCTGGGGGC 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 15
1049844173_1049844183 26 Left 1049844173 8:144792126-144792148 CCATGGCGACGGGTCCTGGGGGC 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1049844183 8:144792175-144792197 CCCGGGTACCCCCGCCAGCCCGG 0: 1
1: 0
2: 2
3: 18
4: 172
1049844173_1049844175 -5 Left 1049844173 8:144792126-144792148 CCATGGCGACGGGTCCTGGGGGC 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1049844175 8:144792144-144792166 GGGGCGACTCACGATTAGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 11

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049844173 Original CRISPR GCCCCCAGGACCCGTCGCCA TGG (reversed) Exonic
900129685 1:1082085-1082107 GACCCCAGGACTCAGCGCCAGGG + Exonic
900989537 1:6091993-6092015 GGCCCCAGGACCCCACCCCAAGG + Intronic
901696748 1:11013136-11013158 ACCGCCAGGACCTGTCGCCGCGG + Intronic
902812453 1:18896331-18896353 GCCCCCAGGACTGGACTCCAAGG + Intronic
905365523 1:37449121-37449143 ACCCCCAGGACCCATGCCCAGGG - Intergenic
905369255 1:37474574-37474596 ACCCCCAGGACTCGGCCCCATGG + Exonic
907526011 1:55054534-55054556 GTCTCCAGGAGCCGTGGCCAAGG - Intronic
910936460 1:92486826-92486848 GCCCGCGGGACGCGCCGCCAGGG - Intronic
914255832 1:145960857-145960879 GCCCTGAGGACCCGCCCCCATGG - Exonic
915463500 1:156082774-156082796 GCCCCCAGGACCGGCCGGCGCGG - Intronic
915637052 1:157194833-157194855 GCCCCGGGGACCCTTCGCCTGGG - Intergenic
916059263 1:161087627-161087649 GCCCCCAGGCCCGGTCACTATGG - Intronic
917904484 1:179575675-179575697 GCCCCGAGCGCCCGCCGCCACGG - Exonic
924569474 1:245225282-245225304 ACCCCCAGGACCCTTCTCCTTGG - Intronic
1062937795 10:1401055-1401077 AGTCCCAGGACCCCTCGCCAGGG + Intronic
1063373135 10:5534579-5534601 ACCCGCAGGACCCGTCGGCCAGG + Intergenic
1067825532 10:49569952-49569974 GCGCCCAGGACCCCTTTCCAAGG + Intergenic
1071510782 10:86261308-86261330 GCCCCCAGGACCTGCCGGCATGG + Intronic
1074379841 10:112970397-112970419 GCCACCAGGACCCTCCTCCAGGG + Intronic
1076221588 10:128738009-128738031 GTCCCCAGCACCCGTCGAAAGGG + Intergenic
1076679707 10:132165416-132165438 GCCCCCAGGACCAATCACAATGG - Intronic
1076922178 10:133459822-133459844 TCCCCCATGGCCCGTCGCCACGG + Intergenic
1077334283 11:1996580-1996602 GCCTCCAGAGCCCGTGGCCAAGG - Intergenic
1077976470 11:7252592-7252614 GCCCCCAGGAGCCTTGGCGATGG - Intronic
1079024990 11:16940025-16940047 GCCCCCAGCACCAGTGGCCCTGG - Intronic
1083174253 11:60939373-60939395 GCCCCCAGGGCCCATCTGCATGG - Intronic
1083431036 11:62613564-62613586 GGGCCCAGGACCCCTCGCCAGGG - Exonic
1084271521 11:68031739-68031761 TCCCCCAGGAACCGTGCCCAGGG - Intronic
1084365185 11:68693070-68693092 GCCCCCAGATCCAGTGGCCATGG + Intergenic
1084410853 11:69005219-69005241 GCCTCCAAGACCCTTCGCCTTGG - Exonic
1084935171 11:72583111-72583133 TCACCCAGGACCCGTCCCCATGG - Intronic
1085417497 11:76329110-76329132 TCCCCCAGGACCCCGCTCCAGGG + Intergenic
1087757851 11:102073718-102073740 GCCCCCAGCAACAGTGGCCATGG + Intronic
1089286831 11:117412775-117412797 GCCCCCAGCACCCTCCGGCAGGG - Exonic
1090243889 11:125202299-125202321 GCCCCCTGCACCCCTCACCAAGG + Intronic
1091281268 11:134383151-134383173 GCCCCCAGGACCCATCCCATGGG + Intronic
1202817266 11_KI270721v1_random:51762-51784 GCCTCCAGAGCCCGTGGCCAAGG - Intergenic
1091404068 12:198036-198058 GCCCCCAGGGCCCAGAGCCAGGG + Intronic
1093027753 12:14260144-14260166 GGCCCCGGGAGCCGTCACCATGG + Intergenic
1101901136 12:108792125-108792147 GCCCCCAGCTCCCATCTCCAGGG - Intronic
1102370793 12:112381580-112381602 GCCCCCAGGACCCACTTCCAGGG - Intronic
1105016015 12:132787377-132787399 GGACCCAGGACCCCTCCCCAGGG + Intronic
1105016025 12:132787398-132787420 GGCCCCAGGAACCCTCCCCAAGG + Intronic
1112041480 13:95552610-95552632 GCCCAGCGGACCCGGCGCCAGGG - Intronic
1112344027 13:98576317-98576339 GGCCCCAGGACGCGTCCCCCAGG - Intronic
1113887204 13:113667223-113667245 GTCCCCAGGAACCCTCGACAGGG + Exonic
1114485103 14:23057450-23057472 GCCCCCGGGACCCGGCGACGGGG - Exonic
1122299158 14:100722335-100722357 GCCCCCAGGTCCCCTCTCCTCGG + Intergenic
1122582194 14:102777752-102777774 GCCCCCGGGCCCCGCCGCCCAGG - Intronic
1122901948 14:104785671-104785693 GACCCCAGGTCCTGCCGCCAAGG + Intronic
1123056465 14:105572862-105572884 GGCCCCAGGACCGGCCTCCAAGG - Intergenic
1123057468 14:105578945-105578967 GGCCCCAGGACCGGCCTCCAAGG + Intergenic
1123080898 14:105692990-105693012 GGCCCCAGGACCGGCCTCCAAGG - Intergenic
1123081744 14:105698878-105698900 GGCCCCAGGACCGGCCTCCAAGG + Intergenic
1128548558 15:68583440-68583462 TGCCCCAGGACCCCTTGCCAGGG - Intronic
1129660676 15:77551170-77551192 GCCCCCAGTTCCCGTGGCCCAGG - Intergenic
1132719567 16:1309222-1309244 GGCCCCAGGACCTGACCCCAAGG + Exonic
1133046611 16:3091806-3091828 GTCCCCAGGGCCCCTCACCATGG - Exonic
1133784596 16:8964118-8964140 GCCCCCAGGGCCCGGGGGCAGGG - Intronic
1136409074 16:30065962-30065984 GCCCCCAAGATCCCTCTCCACGG - Intronic
1137624591 16:49899838-49899860 GCTCCCAGGGCCCGTTGCCAGGG - Intergenic
1139370087 16:66461666-66461688 TCCCCCATGACCCCTGGCCATGG - Intronic
1142119390 16:88378490-88378512 GCACCCAGGAGCCGTCCTCAGGG + Intergenic
1142271786 16:89093776-89093798 GCGCCCGGAACCCGCCGCCACGG + Intronic
1142328220 16:89432370-89432392 GACCTCAGGACCCATCGCCGTGG + Intronic
1143620169 17:8076038-8076060 GACCCCAGGCCCCTTCCCCAAGG + Intronic
1147946418 17:44082778-44082800 GCCCCCAGGACACCACGCCGAGG - Exonic
1150586365 17:66522141-66522163 ACCTGCAGGACCCGTCGCCCAGG - Intronic
1151758751 17:76089054-76089076 CCACCCAGGACCGGTCCCCAGGG + Intronic
1152585436 17:81187497-81187519 GCCCCCAGGAACCGGCTCCCAGG - Intergenic
1152704983 17:81838770-81838792 GCCCCCTGGGCCCCTCGCCTCGG + Intergenic
1152726487 17:81949217-81949239 GACCCCAGGACATGTCCCCAAGG + Intergenic
1152822334 17:82443760-82443782 GCCCACAGGACCCGTGGCCTTGG - Exonic
1155351480 18:24911697-24911719 GCGCCCAAGACCAGTGGCCATGG + Intergenic
1156459318 18:37312841-37312863 CTCCCCAGGACCCTTGGCCAAGG + Intronic
1160538359 18:79607298-79607320 GCCCGAAGGCCCCGTCTCCATGG + Intergenic
1160729068 19:632521-632543 CCCCCCCGGCCCCGCCGCCAAGG - Intronic
1161470369 19:4454037-4454059 GCCCCCAGGCCGCCCCGCCAGGG - Exonic
1162584245 19:11549480-11549502 GCCCCCGGGACACGCCGTCAAGG + Intronic
1162817973 19:13207677-13207699 TCCCCCAGGGCCTGTCGACACGG - Exonic
1162896196 19:13765903-13765925 GCCACCAGGACCCGGGGCCCAGG - Intronic
1163462694 19:17448459-17448481 GCCCGCAGGAACCCCCGCCATGG - Exonic
1163553905 19:17982157-17982179 GCCCCCAGCCCCCGTCTCCCTGG + Intronic
926621150 2:15048415-15048437 GCCCCCAGGCCTCCTCTCCAAGG + Intergenic
927245246 2:20952316-20952338 GCCCCCAGGCACTGTCGCCTAGG + Intergenic
927552143 2:24010105-24010127 GCCCCCTGCACCAGCCGCCAAGG + Exonic
929188646 2:39120568-39120590 GCCCCCCAGCCCCCTCGCCAGGG - Intronic
930110592 2:47675566-47675588 GCCCCCAGGCCCAGCTGCCAAGG + Intergenic
932713959 2:74088114-74088136 GCCCCTAGGAGCCTTCCCCAGGG - Intronic
937853490 2:126656324-126656346 GTCCCCAGGACCCTTCCCCACGG - Intronic
938502263 2:131836237-131836259 GCCTCCAGGAGCCGTGTCCACGG - Intergenic
946416676 2:219543484-219543506 GCCCGCAGGGCCCGTGGCCGTGG - Exonic
948209268 2:236179875-236179897 GTCCCCAGCACCAGTCCCCAAGG - Intergenic
948478139 2:238234483-238234505 GCCCCCCGAACCCGGCTCCAAGG + Intergenic
948553313 2:238790615-238790637 GCCCCCATGTGCCGTTGCCATGG - Intergenic
1170892222 20:20385710-20385732 GCCCTGAGGACCCCACGCCAAGG + Intergenic
1171439453 20:25148549-25148571 GCCCCCAGGGCCCGGCGTCCTGG + Intergenic
1171457193 20:25278762-25278784 GCCCCCAGCCCCGGTGGCCACGG + Intronic
1173803823 20:45911449-45911471 ACCCCCAGGCCCGCTCGCCATGG - Exonic
1174304478 20:49605441-49605463 GCCCCCAGAAGCAGCCGCCAAGG + Intergenic
1174486739 20:50865992-50866014 GCCCCCAGGTCCTGTCCCCTAGG - Intronic
1175883903 20:62277368-62277390 GCCGCCAGCACCCTTCCCCAGGG + Intronic
1176120682 20:63453232-63453254 GCCCTGAGGCACCGTCGCCAGGG + Intronic
1176161791 20:63652268-63652290 GCCCCCGGGACAGGTCGCCGCGG - Intronic
1179707961 21:43193548-43193570 GGCCCCAGGTCCCCTGGCCATGG - Intergenic
1179708454 21:43195691-43195713 GTCCCCAGGACCCCTATCCACGG - Intergenic
1181600643 22:23949854-23949876 GTCCCCAGGGCCCGTCCCCTGGG + Intergenic
1181607868 22:23991468-23991490 GTCCCCAGGGCCCGTCCCCTGGG - Intergenic
965956499 3:174377225-174377247 GTGAGCAGGACCCGTCGCCATGG + Intergenic
968744548 4:2352952-2352974 GCCCCCAGCACCTGTCCCCTGGG + Intronic
968956272 4:3721391-3721413 GCCCCCAGGTCCCAGCCCCACGG - Intergenic
969606620 4:8205235-8205257 TCCCACAGGACCCCTCCCCATGG - Exonic
969608985 4:8216656-8216678 ACCCCCAGGGCCCTTCTCCATGG - Intronic
971353440 4:25872925-25872947 GCCCCCCCGACCCATCACCATGG + Intronic
975497002 4:75046193-75046215 TTCCCCAGGACCCGTAGTCATGG - Exonic
985511460 5:316323-316345 GCCCCCAGCACATGTCTCCATGG + Intronic
985684394 5:1274163-1274185 GCCCCCAGGAGCTGGCGGCAGGG + Intronic
986233606 5:5887369-5887391 GCCCACAGGACCCGTCCTCGAGG - Intergenic
998157505 5:139795314-139795336 GCCCCCGGGAGACGCCGCCAAGG - Intergenic
1001043956 5:168356840-168356862 TCCACCAGGAACCGTCTCCATGG - Intronic
1002514967 5:179750914-179750936 GCCCCCGGGACCTGCCGCCTGGG - Intronic
1002711176 5:181195789-181195811 CCCCCCAGCACCCAGCGCCAAGG + Intronic
1002786463 6:404080-404102 GCCCCCAGGGCCCGGCCCGAGGG + Intronic
1003502721 6:6715578-6715600 CCCCCCAGGACCAGGCCCCATGG + Intergenic
1004638416 6:17490702-17490724 GCCTCCAGGATCCTTCTCCAAGG - Intronic
1007414828 6:41685126-41685148 GCCACCAGGACCCCTCCCCTGGG + Intronic
1007911101 6:45514762-45514784 GCTCCCAGGACTAGTCCCCAGGG - Intronic
1023287094 7:38631348-38631370 GCTCCCCGGACCCGCAGCCATGG - Exonic
1024985875 7:55192633-55192655 CACCCCAGGACCCGTCCCCCAGG - Intronic
1029259105 7:99289383-99289405 GCCATCAGGACCCGCCTCCAAGG + Intergenic
1035096443 7:156360010-156360032 TTCCCCAGGACCCCACGCCAAGG - Intergenic
1035168489 7:157005382-157005404 GCCCCATGGACCCCTCGCCCAGG - Exonic
1035652167 8:1275438-1275460 GGCCCCAGGACCAGTGTCCAAGG - Intergenic
1041260710 8:56018756-56018778 GCCCCCAGGGCCCGGGGCAAGGG + Intergenic
1044599783 8:93992065-93992087 GCCACGTGGACCCCTCGCCAGGG - Intergenic
1044820593 8:96153486-96153508 CCCCCCAGGTCCCGGCCCCAGGG - Intronic
1046918161 8:119699364-119699386 ACCCCCAGGACCCCTCCACAGGG + Intergenic
1049844173 8:144792126-144792148 GCCCCCAGGACCCGTCGCCATGG - Exonic
1058908482 9:109499658-109499680 GCCCCCAGGACCTGGCACCCAGG - Intergenic
1059269933 9:113065541-113065563 GCCCCCAGGAGCGGGCGCAAAGG + Intergenic
1059271067 9:113070989-113071011 GCCCCCAGGAGCGGGCGCAAAGG + Intergenic
1059272200 9:113076435-113076457 GCCCCCAGGAGCGGGCGCAAAGG + Intergenic
1059273335 9:113081877-113081899 GCCCCCAGGAGCGGGCGCAAAGG + Intergenic
1059274471 9:113087323-113087345 GCCCCCAGGAGCGGGCGCAAAGG + Intergenic
1062025834 9:134340237-134340259 GCCCTCAGGACCCTTAGCTAAGG - Intronic
1062390521 9:136331940-136331962 CCCCCCAGGACCCGTGGCCATGG + Intronic
1062460138 9:136659539-136659561 GCCTCCCGGACCCCTCACCAGGG - Exonic
1062506639 9:136880907-136880929 CCCGCCAGGACCAGTCACCACGG - Intronic
1062518956 9:136949787-136949809 GCCCCAGGGACCGGTCCCCACGG + Intronic
1062587730 9:137257028-137257050 TCCCCCAAGACCAGGCGCCAGGG + Exonic
1187063323 X:15808951-15808973 GCCACCAGGGGCAGTCGCCAAGG - Intronic
1190984545 X:55489060-55489082 GCCCCCAGGACCCCTCCCATCGG + Intronic
1198606783 X:138348687-138348709 GCCCCCAAGACCTGAAGCCAAGG + Intergenic