ID: 1049844176

View in Genome Browser
Species Human (GRCh38)
Location 8:144792148-144792170
Sequence CGACTCACGATTAGCGCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 2}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049844171_1049844176 0 Left 1049844171 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 1
3: 4
4: 83
Right 1049844176 8:144792148-144792170 CGACTCACGATTAGCGCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 2
1049844165_1049844176 15 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844176 8:144792148-144792170 CGACTCACGATTAGCGCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 2
1049844173_1049844176 -1 Left 1049844173 8:144792126-144792148 CCATGGCGACGGGTCCTGGGGGC 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1049844176 8:144792148-144792170 CGACTCACGATTAGCGCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 2
1049844163_1049844176 22 Left 1049844163 8:144792103-144792125 CCTCTGTCCACGGATCACACGGC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1049844176 8:144792148-144792170 CGACTCACGATTAGCGCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 2
1049844160_1049844176 27 Left 1049844160 8:144792098-144792120 CCCTTCCTCTGTCCACGGATCAC 0: 1
1: 0
2: 5
3: 22
4: 191
Right 1049844176 8:144792148-144792170 CGACTCACGATTAGCGCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 2
1049844161_1049844176 26 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844176 8:144792148-144792170 CGACTCACGATTAGCGCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 2

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049844176 Original CRISPR CGACTCACGATTAGCGCGGC CGG Intronic
926101436 2:10120730-10120752 TGACTCAGGTTTAGCGCGGGAGG + Intergenic
952942270 3:38454015-38454037 CGACTCAGGCATAGCGCGGCGGG - Exonic
1033099767 7:138460350-138460372 CGCCTCCCGAGTGGCGCGGCCGG - Exonic
1049844176 8:144792148-144792170 CGACTCACGATTAGCGCGGCCGG + Intronic