ID: 1049844177

View in Genome Browser
Species Human (GRCh38)
Location 8:144792149-144792171
Sequence GACTCACGATTAGCGCGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 15}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049844165_1049844177 16 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 15
1049844160_1049844177 28 Left 1049844160 8:144792098-144792120 CCCTTCCTCTGTCCACGGATCAC 0: 1
1: 0
2: 5
3: 22
4: 191
Right 1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 15
1049844163_1049844177 23 Left 1049844163 8:144792103-144792125 CCTCTGTCCACGGATCACACGGC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 15
1049844171_1049844177 1 Left 1049844171 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 1
3: 4
4: 83
Right 1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 15
1049844161_1049844177 27 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 15
1049844173_1049844177 0 Left 1049844173 8:144792126-144792148 CCATGGCGACGGGTCCTGGGGGC 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049844177 Original CRISPR GACTCACGATTAGCGCGGCC GGG Intronic
905553199 1:38859924-38859946 GAGTCACGAGGAGGGCGGCCCGG + Intronic
1065308971 10:24395875-24395897 GTCTCACGATTAGCCCAGGCTGG + Intronic
1095753028 12:45730580-45730602 AACTCAAAATTAGCGCGGGCAGG + Intronic
1107989822 13:45810008-45810030 GACTCAGGACTAGCTCGACCAGG - Intronic
1113089061 13:106598077-106598099 GACTCACGTTTACCCCTGCCTGG - Intergenic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1164694985 19:30236718-30236740 GACAAACGATTAGCTCAGCCAGG + Intronic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
930177391 2:48314799-48314821 GACTCACCGTCAGCTCGGCCGGG - Exonic
937665591 2:124483389-124483411 GAATCACCATTAGCGCAGGCCGG + Intronic
952942269 3:38454014-38454036 GACTCAGGCATAGCGCGGCGGGG - Exonic
959847062 3:111045652-111045674 GACTCACGATTAGGGTTGTCAGG - Intergenic
972352462 4:38248695-38248717 GACTCATGATCAGCGCGCCTTGG - Intergenic
1009520944 6:64681587-64681609 GAATCACTTTTAGCGAGGCCAGG - Intronic
1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG + Intronic
1185915391 X:4028817-4028839 TGCTCACGATTAGGGCTGCCAGG + Intergenic
1189310014 X:40012396-40012418 GCCCCAGGATTAGCGCGGCCAGG + Intergenic