ID: 1049844178

View in Genome Browser
Species Human (GRCh38)
Location 8:144792152-144792174
Sequence TCACGATTAGCGCGGCCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 16
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 15}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049844161_1049844178 30 Left 1049844161 8:144792099-144792121 CCTTCCTCTGTCCACGGATCACA 0: 1
1: 0
2: 2
3: 23
4: 175
Right 1049844178 8:144792152-144792174 TCACGATTAGCGCGGCCGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 15
1049844171_1049844178 4 Left 1049844171 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 1
3: 4
4: 83
Right 1049844178 8:144792152-144792174 TCACGATTAGCGCGGCCGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 15
1049844165_1049844178 19 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844178 8:144792152-144792174 TCACGATTAGCGCGGCCGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 15
1049844173_1049844178 3 Left 1049844173 8:144792126-144792148 CCATGGCGACGGGTCCTGGGGGC 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1049844178 8:144792152-144792174 TCACGATTAGCGCGGCCGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 15
1049844163_1049844178 26 Left 1049844163 8:144792103-144792125 CCTCTGTCCACGGATCACACGGC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1049844178 8:144792152-144792174 TCACGATTAGCGCGGCCGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049844178 Original CRISPR TCACGATTAGCGCGGCCGGG CGG Intronic
919289882 1:195615751-195615773 TAAAGATTAGCGAGGCCTGGTGG - Intergenic
1065775517 10:29115997-29116019 TCACGATTCTGGTGGCCGGGAGG - Intergenic
1107843917 13:44491011-44491033 TCACAATTAGCCAGGCCTGGTGG + Intronic
1126467702 15:48975958-48975980 TCTCGAGAAGCCCGGCCGGGCGG + Intergenic
1165536778 19:36454398-36454420 TCAGGATTAGCTCGGCAGAGGGG + Intronic
930177390 2:48314796-48314818 TCACCGTCAGCTCGGCCGGGAGG - Exonic
938856713 2:135320191-135320213 TCACTTTTAGCTCGGCCTGGTGG - Intronic
1184766986 22:46577211-46577233 GCAGGCGTAGCGCGGCCGGGCGG + Intronic
952975067 3:38686903-38686925 TCACGATTAGATAGGCCGGTCGG + Intergenic
1033099765 7:138460346-138460368 TCCCGAGTGGCGCGGCCGGAAGG - Exonic
1040906964 8:52479316-52479338 TCACGCTGAGCGCGGAGGGGCGG - Intergenic
1043298509 8:78697464-78697486 TCACGATTACCGCAGCCAAGTGG + Exonic
1049844178 8:144792152-144792174 TCACGATTAGCGCGGCCGGGCGG + Intronic
1053079057 9:35159573-35159595 TCAAGATTAGCCGGGCCTGGTGG - Intergenic
1057228885 9:93306889-93306911 TCAGGGTTCCCGCGGCCGGGCGG + Intronic
1062127597 9:134871940-134871962 ACACGATAAGTGGGGCCGGGTGG - Intergenic