ID: 1049844179

View in Genome Browser
Species Human (GRCh38)
Location 8:144792157-144792179
Sequence ATTAGCGCGGCCGGGCGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049844173_1049844179 8 Left 1049844173 8:144792126-144792148 CCATGGCGACGGGTCCTGGGGGC 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1049844179 8:144792157-144792179 ATTAGCGCGGCCGGGCGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 59
1049844165_1049844179 24 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844179 8:144792157-144792179 ATTAGCGCGGCCGGGCGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 59
1049844171_1049844179 9 Left 1049844171 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 1
3: 4
4: 83
Right 1049844179 8:144792157-144792179 ATTAGCGCGGCCGGGCGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 59
1049844174_1049844179 -6 Left 1049844174 8:144792140-144792162 CCTGGGGGCGACTCACGATTAGC 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1049844179 8:144792157-144792179 ATTAGCGCGGCCGGGCGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049844179 Original CRISPR ATTAGCGCGGCCGGGCGGCC CGG Intronic
910935113 1:92480884-92480906 TACAGCGCGGCCGGGTGGCCAGG + Exonic
916170344 1:161997241-161997263 ATTAGCTTGGCCTGGCTGCCAGG - Intronic
917359410 1:174159685-174159707 ACGAGGGCGGCCCGGCGGCCCGG + Intronic
923591822 1:235327297-235327319 ATTCGCTCGGCCGGGCGCCGAGG - Intronic
1064552783 10:16520455-16520477 GTGAGCGCGGGCGGGCGGCGGGG - Intronic
1077008440 11:369701-369723 CTGAGCGCGGCGGGGCGGGCCGG + Intergenic
1083295138 11:61711256-61711278 ATGGGTGCGGCCGGGCAGCCTGG - Intronic
1083854730 11:65387059-65387081 CTCAGCGGGGCCGGGCTGCCCGG - Exonic
1096533913 12:52258709-52258731 ATGCAGGCGGCCGGGCGGCCTGG - Intronic
1099076977 12:78122033-78122055 ATTAGCGCGGCAAGGCAGTCTGG + Exonic
1099166520 12:79313880-79313902 ATTAGCGGGGCCGGGCGCGGTGG + Intronic
1101788097 12:107903796-107903818 ATGGGCGCGGCCGGGCTGCCGGG - Intergenic
1114786558 14:25606595-25606617 ATTAGCGTGGCCGGGCGCGGTGG - Intergenic
1119906316 14:78305296-78305318 TTTAGGGCGGCCGGGCAGCAGGG + Intronic
1121547004 14:94769961-94769983 TGCAGCGCGGCCGGGCGGCTAGG + Exonic
1125201226 15:37101850-37101872 TGTGGCGCGGCCGGGCGGACAGG + Intergenic
1126467705 15:48975963-48975985 AGAAGCCCGGCCGGGCGGCGGGG + Intergenic
1141694813 16:85614231-85614253 ATCAGCGCGGCCGCAGGGCCCGG - Intronic
1142421379 16:89972593-89972615 ATGCGCGCGCCCGGGCGGCGCGG + Intergenic
1143172739 17:4939558-4939580 CTAAGCTCGGCCGGGCGGCAGGG - Intronic
1148081105 17:44968108-44968130 GACGGCGCGGCCGGGCGGCCCGG - Intergenic
1148798007 17:50206508-50206530 ATTAGCCCGGCATGGCGGCATGG + Intergenic
1156088749 18:33440553-33440575 AGTCGCGCAGGCGGGCGGCCAGG + Intronic
1156350639 18:36298298-36298320 GTTAGCTCGGCCGGGTGGGCGGG + Intronic
1163144992 19:15373944-15373966 ATGATGGCGGCCTGGCGGCCGGG - Exonic
1163701943 19:18790539-18790561 GTGAGCGCGGCGGGGCGGTCGGG - Intronic
1165696905 19:37907432-37907454 GTCAGCGCGGGCGGACGGCCGGG + Intronic
1166218843 19:41352956-41352978 AGTCCCGCGGCCGGCCGGCCAGG + Exonic
1167369620 19:49072723-49072745 AATAGCCCGGCAGGGCGGCTAGG + Exonic
1168535595 19:57166593-57166615 ATTATGGCGGCCGGGCGCCGTGG - Intronic
935971600 2:108534672-108534694 CCTGGCGCGGGCGGGCGGCCGGG + Intronic
940265128 2:151828337-151828359 TTGCGCGCGGCAGGGCGGCCTGG - Exonic
947306103 2:228749284-228749306 ATTAGTGCGGCCGGGCGCGGTGG + Intergenic
1179783845 21:43718986-43719008 CCTGGCGCGGCCGCGCGGCCAGG + Intergenic
1180874702 22:19169707-19169729 ATTAGCGCGGTACCGCGGCCGGG + Intergenic
1181017559 22:20080093-20080115 AATAGCGCGGCCGCGCGGGAGGG - Intergenic
1181710703 22:24685967-24685989 TTTCGCGCGGCAGGGCGGCCTGG + Intergenic
953387280 3:42513744-42513766 CTCAGGGCGGCCAGGCGGCCAGG + Exonic
956420268 3:69080089-69080111 GTTAGTGCTGCCGGGAGGCCGGG - Intronic
958942952 3:100334950-100334972 GATCGCGTGGCCGGGCGGCCGGG + Intronic
959073398 3:101724948-101724970 CTTCGCGCGGCCCGGCGCCCTGG + Intronic
969706545 4:8795265-8795287 ATCAGCAGGGCCAGGCGGCCTGG + Intergenic
974859239 4:67499061-67499083 ATTAGAGCTGCTGGGTGGCCTGG + Intronic
986858831 5:11903791-11903813 AGTTGCGGGGCTGGGCGGCCGGG - Intronic
998180710 5:139938502-139938524 ATTAGCGGGGCATGGTGGCCTGG - Intronic
998861388 5:146447502-146447524 GGTAGCGGAGCCGGGCGGCCCGG + Intronic
1011734466 6:90297137-90297159 CTTTGTGCGGCCGCGCGGCCCGG + Intergenic
1017880674 6:158560446-158560468 CTAACCGCGGCCGGGCGGGCAGG - Intronic
1018046450 6:159969714-159969736 CCTCGCGCGGCCGGGCGTCCGGG + Intronic
1019232989 6:170584448-170584470 CTGGGCGCGGCCGGGCTGCCGGG - Exonic
1019329531 7:455721-455743 ATGTGGGCGGCCGGGCGGGCGGG - Intergenic
1021685503 7:23181984-23182006 AGTAGCCCGGCCGGGCGCCGAGG + Exonic
1022923246 7:35037151-35037173 CCCAGCGCAGCCGGGCGGCCAGG + Intronic
1026038120 7:66844512-66844534 ATGAGCGGCGCCGGGCGGCGGGG + Intergenic
1035662498 8:1358770-1358792 CTAAGCGGGGCTGGGCGGCCTGG + Intergenic
1036844522 8:12155655-12155677 ATTAGTGGGGCCGGGCGCCGTGG - Intergenic
1036865892 8:12397988-12398010 ATTAGTGGGGCCGGGCGCCGTGG - Intergenic
1049844179 8:144792157-144792179 ATTAGCGCGGCCGGGCGGCCCGG + Intronic
1057207877 9:93184343-93184365 ATGCCCGCGGCCCGGCGGCCAGG - Intergenic
1057245221 9:93449771-93449793 ATTAGTGCGGCCGGGCGTGGTGG - Intronic
1062656108 9:137605328-137605350 ATGAGCGCGGCCGGGGGGCGGGG + Intergenic
1187830455 X:23375567-23375589 GTCAGCCCGGCCGGGCGGCGCGG - Intronic
1190303045 X:49067473-49067495 CTGAGCTAGGCCGGGCGGCCCGG - Exonic