ID: 1049844180

View in Genome Browser
Species Human (GRCh38)
Location 8:144792158-144792180
Sequence TTAGCGCGGCCGGGCGGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049844165_1049844180 25 Left 1049844165 8:144792110-144792132 CCACGGATCACACGGCCCATGGC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1049844180 8:144792158-144792180 TTAGCGCGGCCGGGCGGCCCGGG 0: 1
1: 0
2: 1
3: 7
4: 92
1049844171_1049844180 10 Left 1049844171 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 1
3: 4
4: 83
Right 1049844180 8:144792158-144792180 TTAGCGCGGCCGGGCGGCCCGGG 0: 1
1: 0
2: 1
3: 7
4: 92
1049844173_1049844180 9 Left 1049844173 8:144792126-144792148 CCATGGCGACGGGTCCTGGGGGC 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1049844180 8:144792158-144792180 TTAGCGCGGCCGGGCGGCCCGGG 0: 1
1: 0
2: 1
3: 7
4: 92
1049844174_1049844180 -5 Left 1049844174 8:144792140-144792162 CCTGGGGGCGACTCACGATTAGC 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1049844180 8:144792158-144792180 TTAGCGCGGCCGGGCGGCCCGGG 0: 1
1: 0
2: 1
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049844180 Original CRISPR TTAGCGCGGCCGGGCGGCCC GGG Intronic
904322588 1:29707255-29707277 CTAGCGCGGCTGGGCGGGGCCGG + Intergenic
904775083 1:32901421-32901443 GCTGCGGGGCCGGGCGGCCCGGG - Intronic
905111074 1:35594988-35595010 TTAGCGTGGCTGGGTGGCCGTGG + Exonic
906306717 1:44724435-44724457 TTGGCGCTGCCGGCGGGCCCCGG + Intronic
910182996 1:84505987-84506009 TGAGCGGGGGCGGGCGGCCGAGG - Intronic
911612253 1:99970094-99970116 TCAGCTCCGCCGGGCGCCCCAGG - Intronic
915490078 1:156245946-156245968 CTGGCGCTGGCGGGCGGCCCCGG - Exonic
920504779 1:206507984-206508006 TTGGTGCTGCCGGGCGGCCCCGG + Exonic
922477184 1:225914653-225914675 TTAGAGGGGCCAGGCTGCCCTGG - Intronic
1075106499 10:119543016-119543038 TTAGCGCGTCCCGGGGTCCCTGG + Intergenic
1075521832 10:123148023-123148045 GCAGCGCCGCCGAGCGGCCCCGG - Intergenic
1076850005 10:133088095-133088117 GGAGCGCGGCCCGGCCGCCCCGG + Exonic
1077008441 11:369702-369724 TGAGCGCGGCGGGGCGGGCCGGG + Intergenic
1077339790 11:2021192-2021214 CTGGCGCGGCCGGGCGGTGCAGG + Intergenic
1079353493 11:19712777-19712799 TGGGCGCGCCGGGGCGGCCCCGG + Intronic
1083999626 11:66289077-66289099 GTCGCGCGGCCGGGTGGCCTCGG - Exonic
1084024394 11:66438727-66438749 AAAGCTCGGCCGGGCCGCCCGGG - Exonic
1084978153 11:72814446-72814468 ATGGCGGGGCCGGGCGTCCCCGG + Exonic
1090086375 11:123654341-123654363 GTAGCCCAGACGGGCGGCCCCGG - Exonic
1202822775 11_KI270721v1_random:76381-76403 CTGGCGCGGCCGGGCGGTGCAGG + Intergenic
1097166782 12:57090193-57090215 TTAACCAGGCCGGGCGGGCCCGG + Intronic
1101788096 12:107903795-107903817 TGGGCGCGGCCGGGCTGCCGGGG - Intergenic
1117722107 14:58638154-58638176 TCACCGCAGCCGGGCCGCCCAGG - Intronic
1118725820 14:68628452-68628474 TTTGTGCAGCAGGGCGGCCCGGG - Intronic
1119906317 14:78305297-78305319 TTAGGGCGGCCGGGCAGCAGGGG + Intronic
1122750325 14:103928302-103928324 CTAGCGCGGCGGGGCGGGGCCGG + Intergenic
1123676070 15:22711076-22711098 TTAGCGGGGCCTGGTGGGCCCGG + Intergenic
1124328269 15:28784990-28785012 TTAGCGGGGCCTGGTGGGCCCGG + Intergenic
1126106891 15:45152546-45152568 TCAGCGGGGGCGGGAGGCCCTGG - Intronic
1129256221 15:74335576-74335598 TTTGCGGGGCTGGGCGGTCCCGG - Intronic
1132778794 16:1611899-1611921 TTAGCGTAGCCGAGCGGCGCTGG - Intronic
1138178795 16:54929072-54929094 TAAGCGAGGCGGAGCGGCCCAGG - Intergenic
1139548538 16:67661018-67661040 ATGGCGGGGCCGGGCGGGCCGGG - Exonic
1141694812 16:85614230-85614252 TCAGCGCGGCCGCAGGGCCCGGG - Intronic
1142421380 16:89972594-89972616 TGCGCGCGCCCGGGCGGCGCGGG + Intergenic
1143172738 17:4939557-4939579 TAAGCTCGGCCGGGCGGCAGGGG - Intronic
1143904633 17:10198767-10198789 TCCGCGCGCCAGGGCGGCCCCGG - Intergenic
1146214941 17:30971402-30971424 CCAGCGCGGCCGCGAGGCCCCGG + Exonic
1147636350 17:41966816-41966838 TCCGCGCAGGCGGGCGGCCCCGG + Exonic
1148930122 17:51120867-51120889 CGCGCGCGGCCGGGCCGCCCCGG - Intergenic
1152197304 17:78925224-78925246 TTTGCGCGGCCGAGCGGGGCAGG - Exonic
1152729182 17:81961421-81961443 GCAGCGCGGCCGGGCGGCCCCGG + Intronic
1152924055 17:83079573-83079595 TGAGCCCGGCCGGGCGGACTCGG + Intergenic
1152980112 18:268438-268460 TGACCGCGGACTGGCGGCCCAGG - Intergenic
1156350640 18:36298299-36298321 TTAGCTCGGCCGGGTGGGCGGGG + Intronic
1158530556 18:58256279-58256301 CTGCCGCGGCCGGGCCGCCCTGG - Intronic
1160453283 18:78979574-78979596 TCAGCGCGGCGGGCCCGCCCGGG - Intergenic
1160949442 19:1658463-1658485 TTAGCGTGGCAAGGCGTCCCTGG - Intergenic
1161419890 19:4171004-4171026 TTAGCGGGGCTGGGGGACCCCGG + Intronic
1162379561 19:10323406-10323428 ATACTGCGGCCGGGGGGCCCAGG + Exonic
1162398378 19:10430845-10430867 ATGGCGCGGCCGCGCGGCCTAGG + Intronic
1162944070 19:14031813-14031835 GCAGCGCGGCCGCGCGGACCCGG + Exonic
1165153254 19:33773080-33773102 TGACCGGGGCAGGGCGGCCCCGG - Exonic
926118068 2:10225733-10225755 TTAACCCAGCCTGGCGGCCCAGG - Intergenic
929788578 2:45008561-45008583 GCAGCGCGACCGGGCGGCCGAGG - Exonic
934954734 2:98608284-98608306 GTAGCGCGGCCGGGCGCTCCCGG - Intronic
940265127 2:151828336-151828358 TGCGCGCGGCAGGGCGGCCTGGG - Exonic
942023938 2:171894403-171894425 TCCGCCCGGCCGGCCGGCCCTGG - Intronic
942454799 2:176130323-176130345 TTAGCGCCGCCCGCCCGCCCGGG + Exonic
948989021 2:241542352-241542374 CTGGCGAGGCCGGGAGGCCCAGG - Intergenic
1172280372 20:33703652-33703674 TCAGCCCTGCTGGGCGGCCCTGG + Exonic
1174204282 20:48827862-48827884 CTAGCGCGGCCGCGCGGCGCCGG + Exonic
1179783846 21:43718987-43719009 CTGGCGCGGCCGCGCGGCCAGGG + Intergenic
1181710704 22:24685968-24685990 TTCGCGCGGCAGGGCGGCCTGGG + Intergenic
950018452 3:9769915-9769937 AGAGCGCGGGCGGGTGGCCCAGG - Exonic
950203586 3:11061471-11061493 TCAGAGCGGCCGGCCGGCCTCGG + Intergenic
954367705 3:50155172-50155194 CCAGCGCGGCCGCCCGGCCCGGG + Exonic
956392200 3:68785537-68785559 TAGGAGCGGCCGGCCGGCCCTGG - Intronic
956420267 3:69080088-69080110 TTAGTGCTGCCGGGAGGCCGGGG - Intronic
957919674 3:86731710-86731732 TTGGAGCGGCCGGCCAGCCCTGG - Intergenic
962498514 3:135966064-135966086 TCGGCGCGGCCGGCCGGTCCCGG + Intronic
963335790 3:143972272-143972294 TTGGCGCGGCGGGGGCGCCCCGG + Exonic
968756347 4:2418209-2418231 GTAGGGCGGACGGGCGGTCCTGG + Intronic
975161159 4:71125426-71125448 TTAGCTCGGCAGGGTGGCACAGG + Intergenic
987035091 5:14011569-14011591 CATGCGCGGCCGAGCGGCCCGGG - Intergenic
992431620 5:76716105-76716127 TTAGCGGGGCGGGGCGGGACTGG - Exonic
995241053 5:109885442-109885464 TGAGCGGGAGCGGGCGGCCCCGG - Intergenic
998463130 5:142324044-142324066 CTAGCGCGGCCTGGGGGCTCCGG + Intronic
998861389 5:146447503-146447525 GTAGCGGAGCCGGGCGGCCCGGG + Intronic
999868858 5:155729310-155729332 TTAGCGCGCCCAGGCGGCTGCGG - Intergenic
1002401791 5:178995095-178995117 TTAGCTCAGCCGGCCTGCCCGGG + Exonic
1004043953 6:12009173-12009195 CTGGCGCGGCCCCGCGGCCCCGG - Intronic
1004216920 6:13711724-13711746 GGAGCGCGGGCGCGCGGCCCGGG + Intergenic
1006177372 6:32130466-32130488 TTGGCGCGGTCGGGCTGGCCAGG + Intergenic
1006891571 6:37433455-37433477 TAACCGCGGGCGGGGGGCCCAGG - Intronic
1011246510 6:85326069-85326091 TCGGAGCGGCCGGCCGGCCCAGG + Intergenic
1019232988 6:170584447-170584469 TGGGCGCGGCCGGGCTGCCGGGG - Exonic
1019471961 7:1225696-1225718 AGAGCGCGGCCGGGCGGGCTCGG - Intergenic
1023951255 7:44847945-44847967 TAAGGGCGGCCGGGTGGGCCGGG - Intronic
1029537031 7:101163097-101163119 CTATCCCGGCCGGGAGGCCCAGG - Exonic
1037481925 8:19313632-19313654 TGGGCGCGGCGGGGCGGCGCGGG + Exonic
1038554203 8:28494826-28494848 TTCGGGCGGCCGGGAGCCCCCGG - Intronic
1049383487 8:142329390-142329412 CTAACCAGGCCGGGCGGCCCAGG + Intronic
1049844180 8:144792158-144792180 TTAGCGCGGCCGGGCGGCCCGGG + Intronic
1051235338 9:14993231-14993253 TTGGCGCGCCCGAGCGGCGCTGG + Intergenic
1053291046 9:36879812-36879834 TTAGCACGTCCAGGCGGCCTTGG - Intronic
1056126015 9:83537491-83537513 TGAGAGAGGCCGGGCTGCCCTGG - Intronic
1057208144 9:93185233-93185255 GTAGCGCAGCCGGGAGCCCCCGG + Exonic
1057228887 9:93306895-93306917 TTCCCGCGGCCGGGCGGGCGTGG + Intronic
1062008240 9:134252526-134252548 TGAGCGCTGCCAGGCTGCCCAGG - Intergenic
1190303044 X:49067472-49067494 TGAGCTAGGCCGGGCGGCCCGGG - Exonic