ID: 1049844183

View in Genome Browser
Species Human (GRCh38)
Location 8:144792175-144792197
Sequence CCCGGGTACCCCCGCCAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049844171_1049844183 27 Left 1049844171 8:144792125-144792147 CCCATGGCGACGGGTCCTGGGGG 0: 1
1: 0
2: 1
3: 4
4: 83
Right 1049844183 8:144792175-144792197 CCCGGGTACCCCCGCCAGCCCGG 0: 1
1: 0
2: 2
3: 18
4: 172
1049844173_1049844183 26 Left 1049844173 8:144792126-144792148 CCATGGCGACGGGTCCTGGGGGC 0: 1
1: 0
2: 1
3: 7
4: 144
Right 1049844183 8:144792175-144792197 CCCGGGTACCCCCGCCAGCCCGG 0: 1
1: 0
2: 2
3: 18
4: 172
1049844174_1049844183 12 Left 1049844174 8:144792140-144792162 CCTGGGGGCGACTCACGATTAGC 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1049844183 8:144792175-144792197 CCCGGGTACCCCCGCCAGCCCGG 0: 1
1: 0
2: 2
3: 18
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049844183 Original CRISPR CCCGGGTACCCCCGCCAGCC CGG Intronic
900288926 1:1915614-1915636 CCCGGGGACCCCAGGCAGCCAGG + Intronic
901059692 1:6466220-6466242 CCCGCCTCCCCCCGCCCGCCAGG - Exonic
901515672 1:9744293-9744315 CCCAGGGTCCCCTGCCAGCCTGG - Intronic
902323800 1:15684980-15685002 CCCGGGTCCCCCCGCCAGGCTGG + Intronic
904489916 1:30852263-30852285 CCCGGGAATCCACCCCAGCCAGG + Intergenic
904724863 1:32539623-32539645 CCCGGGACCCGCCGCGAGCCTGG + Intronic
913075602 1:115338387-115338409 CCCCAGGACCCCCTCCAGCCGGG - Intergenic
916562087 1:165941774-165941796 CCCGGGTTCCCCCTACATCCTGG - Intergenic
918480734 1:184974284-184974306 CCGAGGTACGCCCGCCCGCCCGG - Exonic
919926426 1:202194076-202194098 CCCGGGGCCCACCGCCTGCCCGG + Exonic
920371129 1:205479989-205480011 CCCCCCTACCCCTGCCAGCCTGG - Intergenic
922518248 1:226223870-226223892 CCCGCCGCCCCCCGCCAGCCTGG + Exonic
923100080 1:230807153-230807175 CCCTGGTACCTCTGCCAACCAGG - Intergenic
1063636534 10:7787992-7788014 CCCGCCCACCGCCGCCAGCCCGG - Intergenic
1064086338 10:12349163-12349185 GCCGCGCACCCCCGCCCGCCCGG + Intergenic
1064231015 10:13529131-13529153 CCCGGGGGCCGCCGCCGGCCTGG + Intergenic
1066111364 10:32199948-32199970 CCCAGGTACCCCCGAGTGCCTGG + Intergenic
1067048754 10:43000241-43000263 CCTGGGTCCCACAGCCAGCCTGG + Intergenic
1069734756 10:70646639-70646661 CCAGGGTACCCACTCCAGCCAGG - Intergenic
1069757916 10:70785151-70785173 CCCTGGGGCCCCAGCCAGCCAGG + Intronic
1070330171 10:75410645-75410667 CCAGTGTAGACCCGCCAGCCAGG - Intergenic
1073491348 10:103855352-103855374 CCCGGGGCCGCCCGCCACCCCGG + Exonic
1074864682 10:117537782-117537804 CCCGGGTCGCCGCGCCCGCCTGG + Intergenic
1076424977 10:130361390-130361412 CCCAGGGACCCCCTCCAGGCTGG - Intergenic
1076732567 10:132446005-132446027 CCCGGGTTTCCCTGCCTGCCTGG + Intronic
1077141681 11:1027572-1027594 CTCGGGTTCCCCTGCCTGCCGGG + Intronic
1077241076 11:1510487-1510509 CCCGGGTCCCCCCGCAGCCCTGG - Intergenic
1077241089 11:1510519-1510541 CCCGGGTCCCCCCGCAGCCCTGG - Intergenic
1077241112 11:1510582-1510604 CCCGGGTCCCCCGGCAAGCCTGG - Intergenic
1077241124 11:1510614-1510636 TCCGGGTCCCCCGGCAAGCCTGG - Intergenic
1077304674 11:1863771-1863793 GCCTGGTGCCCTCGCCAGCCAGG - Intronic
1078180180 11:9004368-9004390 CCCGGGGATCACCGACAGCCGGG + Intergenic
1079031859 11:16992068-16992090 TCCAGGGACCCCCCCCAGCCTGG + Intronic
1081793312 11:45804171-45804193 CCCTGGTACCCCCGCCCGCCCGG - Intronic
1083811658 11:65109931-65109953 CAGGGCTACCCCGGCCAGCCTGG - Intronic
1084693362 11:70739609-70739631 CCAGGGTCCCACCACCAGCCAGG + Intronic
1085295875 11:75431395-75431417 CCATGGCACCCCCGCCAGGCTGG - Intergenic
1091259508 11:134223734-134223756 CCCAGGCACCGCCGACAGCCGGG + Intronic
1095441024 12:42238542-42238564 CCTTGGTACCCCCGGCTGCCGGG + Intronic
1096598707 12:52714492-52714514 CCCGGCTACCGCCGCGGGCCCGG + Intergenic
1102017526 12:109657509-109657531 CCCAGCTAACCCTGCCAGCCTGG - Intergenic
1103968184 12:124653231-124653253 CCCGGGTGCCCCAGCCTGCGTGG - Intergenic
1103989195 12:124786802-124786824 CCCCGGTGGCCCCGCCATCCTGG - Intronic
1106031653 13:26010455-26010477 CCAGGGTAGCCTCACCAGCCAGG - Intronic
1111822223 13:93227901-93227923 CCCGGGCTCCCTGGCCAGCCGGG - Intronic
1111951832 13:94713713-94713735 CCCGGCTACCCAGGCCGGCCTGG + Intergenic
1113294176 13:108939320-108939342 CCCGGGGACCCCAGCAACCCTGG - Intronic
1113539410 13:111094907-111094929 CCAGGGGACCCCAGCCAGCATGG - Intergenic
1119775319 14:77244510-77244532 CCCTGGCTTCCCCGCCAGCCTGG + Intronic
1121001531 14:90454844-90454866 CCCGGGGACCCTGGCCGGCCAGG + Intergenic
1122228114 14:100291448-100291470 CCCACCTACCACCGCCAGCCAGG - Exonic
1122787160 14:104169060-104169082 CCAGGGTGCCCCAGCCAGCCAGG - Intronic
1122818300 14:104326254-104326276 CCCGGGCAGCCTCTCCAGCCTGG + Intergenic
1122960767 14:105092836-105092858 CCCAGGGATCCCCGCAAGCCAGG - Intergenic
1123044332 14:105504029-105504051 GCCCGGCACCCCCGCCAGCTGGG - Intergenic
1128146213 15:65333805-65333827 ACCGGGTTCCCCCCCCAACCAGG - Intronic
1129385146 15:75192257-75192279 CCTGGCTTCCCCAGCCAGCCAGG + Intergenic
1129791018 15:78340600-78340622 CCCGGGGACTCCCTCCTGCCTGG - Intronic
1132385639 15:101398098-101398120 CCTGTGTACCCCCTTCAGCCAGG + Intronic
1132622888 16:876005-876027 CCCGGGTCCCACTGCCACCCAGG - Intronic
1132754161 16:1474656-1474678 CCCAGGCGCCCCCGCCAGCCCGG + Intronic
1132942303 16:2514283-2514305 CCCGGGCGCCCCCGACAGCTCGG - Intronic
1134678150 16:16104890-16104912 GCCGGGCAGCCCCGCCAGCCCGG - Intronic
1136029834 16:27494923-27494945 CACGGTTACCCCCGGCAGCCAGG + Intronic
1136269514 16:29140323-29140345 CCCGGGTGCCCCGGCCACCCAGG + Intergenic
1139467096 16:67159856-67159878 CCTGGGTTCCCACGCCCGCCAGG + Exonic
1139649470 16:68355169-68355191 CCAGGGCACCCAGGCCAGCCGGG - Intronic
1139750501 16:69106642-69106664 GAGGGGTACCCCAGCCAGCCTGG - Intronic
1141984336 16:87570382-87570404 CCCGGGGACTCCTGCCAACCAGG - Intergenic
1142060691 16:88027363-88027385 CCCAGGCACCCCAGCCCGCCAGG - Intronic
1143492860 17:7294260-7294282 CTCGGGAACCCCCGCCCCCCCGG - Exonic
1143917274 17:10303120-10303142 CCTGGGTGTCCCCGCCATCCTGG - Intronic
1144128075 17:12221002-12221024 GCCGGCTAGCCCCGCCGGCCCGG + Intergenic
1144185073 17:12789516-12789538 CCCGGGTCCCCGCGCCGGACTGG + Intergenic
1148807864 17:50273287-50273309 CGCGGGTGCCCCCGGGAGCCGGG - Intronic
1151474239 17:74336623-74336645 AGCGGGTACTCCCCCCAGCCAGG + Intronic
1151976577 17:77487053-77487075 CCTGGGCTCCTCCGCCAGCCCGG + Intronic
1152034807 17:77865538-77865560 CCCGGGGAACCCTGGCAGCCAGG - Intergenic
1152559470 17:81070762-81070784 CCCGGGAGCCCCCGTCTGCCTGG + Intronic
1152777545 17:82212458-82212480 CCCGGGTTCCGCCGCCGGCAAGG - Intronic
1153900650 18:9614596-9614618 CGCGCGCGCCCCCGCCAGCCCGG - Intronic
1160255991 18:77249654-77249676 CCCGGCTTCCCTCGCCCGCCTGG + Intergenic
1160854040 19:1207966-1207988 CCCGGCCACCCCCACCAGCTGGG - Intronic
1160913096 19:1483804-1483826 CCCGGGTCCCCGCCCCCGCCCGG + Intronic
1161779218 19:6279946-6279968 ACCGGAAACCACCGCCAGCCCGG + Exonic
1162449290 19:10744801-10744823 CCTGAGTACCCCAGCCAGCCTGG - Intronic
1162991267 19:14303935-14303957 TCCGGGTCACCCAGCCAGCCAGG + Intergenic
1163020373 19:14478209-14478231 GCCGGGGACCCCGGCCAGACTGG + Exonic
1163773068 19:19202435-19202457 CCCTGGAACCCCTGCCACCCAGG + Intronic
1167295391 19:48646377-48646399 CCCGGCCACCCCCGCCCGCGTGG - Intergenic
1167300117 19:48673151-48673173 CACAGGGACCCCTGCCAGCCAGG + Intergenic
1168330403 19:55564488-55564510 CCCGGGCACCTCCCCCTGCCCGG - Intergenic
929777782 2:44939296-44939318 ACCGGGTTCACCCGCCCGCCCGG + Intergenic
933777323 2:85779004-85779026 CCTGGGTACCTCCTCCAGTCTGG + Intronic
933777332 2:85779036-85779058 CCCGGGTGCCTCCTCCAGCCTGG + Intronic
933777339 2:85779054-85779076 CCTGGGTGCCTCCTCCAGCCTGG + Intronic
933777345 2:85779072-85779094 CCTGGGTGCCCCCTCCAGCCTGG + Intronic
936561321 2:113541906-113541928 GCCGGGGGCCTCCGCCAGCCTGG - Intergenic
936938323 2:117859116-117859138 CCCGGGTGCCACCGGCCGCCAGG - Intergenic
942928108 2:181457410-181457432 CCCGGTTTCTGCCGCCAGCCGGG - Exonic
946038487 2:216763846-216763868 CCCGTGTACCCCAGCCTGTCTGG - Intergenic
946279501 2:218656517-218656539 GCTGTGTACCCACGCCAGCCAGG - Intronic
946389190 2:219405233-219405255 CCCAGGTGCCCCAGCCACCCTGG - Intergenic
946431093 2:219627766-219627788 CCCGGGTCCCCCGCCCTGCCCGG - Intronic
948066936 2:235087899-235087921 CACGGGTCCTCCCGCCAGCACGG + Intergenic
948438085 2:237967266-237967288 TCCGGGTGCCCGCGCCCGCCAGG - Intronic
949041747 2:241852788-241852810 CCCGAGGACCGCAGCCAGCCCGG - Exonic
1168804350 20:663679-663701 CCCGCCGACCCCCGCCGGCCCGG - Exonic
1169897931 20:10524033-10524055 CGCTGGTCCCCCAGCCAGCCAGG - Intronic
1171034732 20:21705944-21705966 CCCGGCCACCCCGGCCACCCCGG + Exonic
1171971534 20:31568138-31568160 CTCGGGCTCCCCAGCCAGCCTGG + Exonic
1172691700 20:36794520-36794542 CCCGGGCATCTCCGCCAGCAAGG + Exonic
1174406953 20:50308973-50308995 CCCGGGGACGCCAGGCAGCCGGG - Intergenic
1176001844 20:62835571-62835593 CCCTGGAACCCCCTCCAGCTGGG - Intronic
1176370620 21:6059779-6059801 CCTGGGGACTCCCTCCAGCCAGG + Intergenic
1176388886 21:6153596-6153618 CCCTGGCACCCCCGAGAGCCGGG - Intergenic
1179640932 21:42746780-42746802 CCCAGGTGCCCCCCACAGCCCGG - Intronic
1179712942 21:43273514-43273536 CCTGGCTGCCCCCTCCAGCCTGG - Intergenic
1179734586 21:43384652-43384674 CCCTGGCACCCCCGAGAGCCGGG + Intergenic
1179752899 21:43478762-43478784 CCTGGGGACTCCCTCCAGCCAGG - Intergenic
1180081706 21:45490299-45490321 CCCGGGTTCCCCGGCCTCCCTGG + Exonic
1180142546 21:45901125-45901147 CCCAGGCACCTCTGCCAGCCTGG + Intronic
1180960520 22:19760554-19760576 CCCGGGGCCCCCCGACCGCCCGG - Intronic
1181064401 22:20298886-20298908 CCCAGGTCCCCAGGCCAGCCAGG - Intergenic
1181478249 22:23181392-23181414 CCGGGGACCCCCCGCCAGCGTGG + Exonic
1182475541 22:30574645-30574667 GCCAGGTGCCGCCGCCAGCCTGG + Intergenic
1182532320 22:30969670-30969692 CCCGGCCACCCCCGCCTCCCCGG - Intergenic
1182972508 22:34591040-34591062 CCCGGATGACCCCACCAGCCAGG - Intergenic
1183975168 22:41507836-41507858 CCTGGATGACCCCGCCAGCCAGG + Exonic
1184467746 22:44678787-44678809 CCCAGGTCTCCCCGACAGCCTGG + Intronic
1184687888 22:46104644-46104666 CCAGGGCTCCCCCGCCAGCGAGG - Intronic
1185175340 22:49323155-49323177 CCAGGAGACCCCAGCCAGCCTGG + Intergenic
1185185415 22:49396448-49396470 CCTGGGTGCCCCTGTCAGCCTGG - Intergenic
952956920 3:38563299-38563321 CCCGGGTGCTCAGGCCAGCCTGG + Intronic
952970796 3:38649316-38649338 CCCGGGGATACCCTCCAGCCGGG + Intronic
955251471 3:57287330-57287352 CCAGAGAACCCCCGGCAGCCTGG + Intronic
965757495 3:172040498-172040520 GCCGGTTACCGCCCCCAGCCCGG - Intronic
968475139 4:801626-801648 CCAGGCTACCCCCAACAGCCTGG + Intronic
968652603 4:1766189-1766211 ACCTGGCACCCCAGCCAGCCTGG - Intergenic
973907369 4:55546051-55546073 CCGGGGAACCCCCGCCCTCCCGG - Intronic
982707170 4:158723150-158723172 CCCGGGAACCCCCGCCTCCTCGG + Intronic
985064311 4:186105497-186105519 CCCAGGAACCCGCTCCAGCCTGG + Intronic
985248175 4:187997062-187997084 CCCGGGGAGCGCCGGCAGCCTGG + Intronic
991996125 5:72388883-72388905 TCCCTGTACCCCAGCCAGCCCGG - Intergenic
1001721523 5:173860754-173860776 TCCGGGGACGCCAGCCAGCCAGG + Intergenic
1002058087 5:176610092-176610114 TGCGGGTCCTCCCGCCAGCCCGG - Exonic
1002313594 5:178329417-178329439 CCAGGCTCCCCCTGCCAGCCAGG + Intronic
1002455870 5:179345144-179345166 CCCCGGGACCCCCGCCGGCCTGG - Intronic
1002470938 5:179435820-179435842 CCTGGGTTCACCCCCCAGCCCGG + Intergenic
1004690220 6:17987264-17987286 CCCGGGCACCACGGCCAGCGCGG + Intronic
1011113053 6:83859735-83859757 CCCGGGGATCGCCGCCAGACGGG - Exonic
1011194454 6:84766978-84767000 CCCGGGTTTCCCCGCCTGCTGGG - Intergenic
1018844638 6:167547235-167547257 CTCGGGGACTCCAGCCAGCCAGG - Intergenic
1019275154 7:172333-172355 CCCCGGGACCCCCACCATCCTGG + Intergenic
1019326292 7:439956-439978 CCTGGGGACTCCCGCCAGGCAGG + Intergenic
1020008272 7:4793626-4793648 GCCGGCTAGCCCCGCCAGCCTGG + Intronic
1020101696 7:5397466-5397488 CCCGGCTGCCCCGCCCAGCCTGG - Intronic
1020105237 7:5419703-5419725 CTCGGAGATCCCCGCCAGCCGGG - Intronic
1022427707 7:30284699-30284721 CCCAGATCCTCCCGCCAGCCCGG + Exonic
1022711768 7:32857180-32857202 CCCGGCTACCCCACCCAGCCAGG - Intergenic
1022912891 7:34917776-34917798 CCCGGCTACCCCACCCAGCCAGG + Intergenic
1023875413 7:44283881-44283903 CCTTGGCACCCCCACCAGCCTGG + Intronic
1023972278 7:45000213-45000235 CCCGGCGCCGCCCGCCAGCCGGG - Intronic
1024965862 7:55021234-55021256 CCCGGGCACCCCAGGCAGGCAGG - Intronic
1027151754 7:75738606-75738628 CCAGGGTACCCCAGCTGGCCTGG - Intronic
1027260588 7:76461964-76461986 CCCGGGTGTCCCCGCCGCCCCGG - Intronic
1027311967 7:76960077-76960099 CCCGGGTGTCCCCGCCGCCCCGG - Intergenic
1033369432 7:140695467-140695489 CCCGGGTTCACCCGCTAGTCCGG + Intronic
1033434739 7:141322708-141322730 CCTGGTTACCCCAGCCTGCCTGG + Intronic
1034415485 7:150962287-150962309 CCCAGGGACCACAGCCAGCCAGG + Intronic
1034500685 7:151448644-151448666 CAGGGGTCGCCCCGCCAGCCCGG + Intergenic
1034622092 7:152464122-152464144 GTCGGGCACCCCCGCCCGCCAGG + Intergenic
1035154453 7:156900753-156900775 CCCGGGTCCCCTCACCATCCTGG + Intergenic
1035589002 8:798867-798889 CCCGTGTCCCGGCGCCAGCCAGG + Intergenic
1038440085 8:27565524-27565546 GCCTGGCACCCCGGCCAGCCAGG + Intergenic
1049224970 8:141446021-141446043 CGCGGGTTCCCCCACCAGCAAGG - Intergenic
1049618322 8:143586206-143586228 CGCGGGTACTCACTCCAGCCAGG + Exonic
1049685933 8:143939313-143939335 CTCGGGCACCCCCGCCAGGCAGG - Intronic
1049844183 8:144792175-144792197 CCCGGGTACCCCCGCCAGCCCGG + Intronic
1049891367 9:73433-73455 GCCGGGGGCCTCCGCCAGCCTGG + Intergenic
1053732792 9:41074505-41074527 GCCGGGGGCCCCCACCAGCCTGG + Intergenic
1056623691 9:88236593-88236615 CCCGGATACCACCACCAGCTGGG - Intergenic
1057292970 9:93818902-93818924 ACCTGGTCCCCCCTCCAGCCAGG - Intergenic
1061382381 9:130266144-130266166 CCCCCGCACCCCCGCCCGCCGGG + Intergenic
1061869798 9:133514668-133514690 CCCGGGGACCCCGGCCAAGCTGG - Exonic
1061931554 9:133835612-133835634 CCCGGGCAGCCCCTCCAGCTGGG - Intronic
1062169549 9:135127315-135127337 GCCCGGTGCCCCCGCCAGCCTGG - Intergenic
1193198208 X:78658112-78658134 CCTGGGAACCCCCAGCAGCCTGG - Exonic
1196102793 X:111865214-111865236 CCATGTTACCCCCCCCAGCCTGG + Intronic
1200059463 X:153477807-153477829 CCAGGGTACCCTCGCCATCCAGG - Intronic
1200115953 X:153769795-153769817 TCCGGGTACACCTGCCAGGCAGG - Exonic
1200141784 X:153906160-153906182 CCTGGGTATCGCCGCCTGCCAGG + Exonic
1200224908 X:154411982-154412004 CCCGGGTACCCATGCCCGGCCGG + Exonic