ID: 1049845174

View in Genome Browser
Species Human (GRCh38)
Location 8:144797280-144797302
Sequence CAGGGGAAACTGGGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049845174_1049845185 11 Left 1049845174 8:144797280-144797302 CCCTCCTCACCCAGTTTCCCCTG No data
Right 1049845185 8:144797314-144797336 AGGAAGAAAATGATGGTTCCTGG No data
1049845174_1049845179 -9 Left 1049845174 8:144797280-144797302 CCCTCCTCACCCAGTTTCCCCTG No data
Right 1049845179 8:144797294-144797316 TTTCCCCTGTCCTTGTGAAAAGG No data
1049845174_1049845184 4 Left 1049845174 8:144797280-144797302 CCCTCCTCACCCAGTTTCCCCTG No data
Right 1049845184 8:144797307-144797329 TGTGAAAAGGAAGAAAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049845174 Original CRISPR CAGGGGAAACTGGGTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr