ID: 1049846252

View in Genome Browser
Species Human (GRCh38)
Location 8:144803258-144803280
Sequence CAGCATCAGGAGAGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 886
Summary {0: 1, 1: 0, 2: 4, 3: 98, 4: 783}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049846252_1049846258 12 Left 1049846252 8:144803258-144803280 CCATCCTCCCTCTCCTGATGCTG 0: 1
1: 0
2: 4
3: 98
4: 783
Right 1049846258 8:144803293-144803315 TGTTAGAAATTGAGACCCAGAGG 0: 1
1: 0
2: 1
3: 20
4: 253
1049846252_1049846262 18 Left 1049846252 8:144803258-144803280 CCATCCTCCCTCTCCTGATGCTG 0: 1
1: 0
2: 4
3: 98
4: 783
Right 1049846262 8:144803299-144803321 AAATTGAGACCCAGAGGGTGGGG 0: 1
1: 0
2: 5
3: 53
4: 471
1049846252_1049846261 17 Left 1049846252 8:144803258-144803280 CCATCCTCCCTCTCCTGATGCTG 0: 1
1: 0
2: 4
3: 98
4: 783
Right 1049846261 8:144803298-144803320 GAAATTGAGACCCAGAGGGTGGG 0: 1
1: 0
2: 11
3: 55
4: 448
1049846252_1049846260 16 Left 1049846252 8:144803258-144803280 CCATCCTCCCTCTCCTGATGCTG 0: 1
1: 0
2: 4
3: 98
4: 783
Right 1049846260 8:144803297-144803319 AGAAATTGAGACCCAGAGGGTGG 0: 1
1: 0
2: 17
3: 132
4: 782
1049846252_1049846259 13 Left 1049846252 8:144803258-144803280 CCATCCTCCCTCTCCTGATGCTG 0: 1
1: 0
2: 4
3: 98
4: 783
Right 1049846259 8:144803294-144803316 GTTAGAAATTGAGACCCAGAGGG 0: 1
1: 1
2: 2
3: 25
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049846252 Original CRISPR CAGCATCAGGAGAGGGAGGA TGG (reversed) Intronic
900320875 1:2082996-2083018 GGACATGAGGAGAGGGAGGACGG - Intronic
900378929 1:2374067-2374089 CACCATGGGGAGAGGGAGGGTGG + Intronic
900597589 1:3489576-3489598 GAGCATCAGCAGTGGGGGGAGGG - Intergenic
900862630 1:5244205-5244227 CAGCAACAGGAAATGGGGGATGG - Intergenic
901020530 1:6252974-6252996 CAGGATCAGGAGACAGAGCAAGG - Intronic
901519055 1:9768874-9768896 AAGCAACAGAAGAGGGAGGGAGG + Intronic
901654241 1:10760230-10760252 CAGCCTCTGGAGATGGAGAAAGG + Intronic
901784251 1:11614124-11614146 CAGCGTCAGGAGAGGGCAGGGGG - Intergenic
901934080 1:12616274-12616296 AGCCATCAGGAGAGGGAGGCAGG - Intronic
902090301 1:13897845-13897867 AAGGACCTGGAGAGGGAGGAAGG - Intergenic
902395331 1:16129378-16129400 CAGCCTCTGGAGTGGGAGGCGGG + Intronic
902594265 1:17497453-17497475 GAGACTCAGAAGAGGGAGGATGG - Intergenic
902700281 1:18167656-18167678 CAGCAGAAGGAAAGGGTGGACGG - Intronic
902762284 1:18590028-18590050 CACCAGGAGGAGAAGGAGGAGGG - Intergenic
903117830 1:21192678-21192700 TGGCAGCAGGAGAGTGAGGAAGG - Intergenic
903178793 1:21595250-21595272 CTGCACCAGTGGAGGGAGGAGGG - Intergenic
903182793 1:21613497-21613519 CAGCCTCAGGATAGGGCGGCAGG + Intronic
903384884 1:22919695-22919717 AGGGAGCAGGAGAGGGAGGAGGG + Intergenic
903413811 1:23168224-23168246 CAGCAGCAGGAGGAGGAGGGCGG - Intronic
903549919 1:24150688-24150710 CAGCAGTAGGAGGAGGAGGAGGG + Intergenic
903826287 1:26147854-26147876 GTGCATCTGGACAGGGAGGATGG + Intergenic
904293609 1:29503615-29503637 CAAGTTCAGGAGAGGGAGGAGGG - Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904881090 1:33697618-33697640 CACCAACAGGAGGGAGAGGAAGG - Intronic
905365864 1:37451229-37451251 CAGCAGCAGGAGAGGGTGTGGGG + Intergenic
905684140 1:39896745-39896767 CAGCATTGGGAGTGGGAGGAAGG + Exonic
905955996 1:41996592-41996614 TAGCATCCTGAGAGGAAGGATGG + Intronic
906280416 1:44549631-44549653 CAGCAGGAGGAAGGGGAGGAAGG - Intronic
906561474 1:46761150-46761172 CAGTATCAAGGGAGGGTGGAGGG + Intronic
907159597 1:52360601-52360623 CAGCTTCCGCAGAGGGAGAATGG - Intronic
907401137 1:54225669-54225691 CAGCTACAGGGGAGGGAGGAAGG + Intronic
907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG + Intronic
907916377 1:58873554-58873576 CAGCAGCAGAATAGGGAGGTTGG - Intergenic
909490024 1:76215849-76215871 CAGCTTCAGGAGATGGATGTAGG + Intronic
909975472 1:82041732-82041754 CAGACTCATGAGAGGGAGGAAGG + Intergenic
910354585 1:86340780-86340802 AAGCCTCAGGAGAGGGTGGTGGG - Intergenic
912285548 1:108364854-108364876 CAGGATGAGGAATGGGAGGAAGG + Intergenic
912475251 1:109930532-109930554 CGGCATCAGGACAGGGAAGGTGG - Exonic
912516017 1:110216981-110217003 CAGGACCAGGAGAGAGAGCAGGG + Intronic
912696721 1:111847744-111847766 CAGCAGCTGGAGAGGGAGGATGG + Intronic
912701566 1:111882033-111882055 CAGCAGCTGTAGAGGGAGGCAGG + Intronic
912719933 1:112011627-112011649 CAGCATCAGGATAGGGTCAAGGG - Intergenic
912938451 1:114024078-114024100 GAGAATGAGGTGAGGGAGGAGGG + Intergenic
913231899 1:116746878-116746900 AAGGTTTAGGAGAGGGAGGAGGG - Intergenic
913318754 1:117574377-117574399 AAGCTGCAGGAGAAGGAGGATGG - Intergenic
913334716 1:117698600-117698622 CAGCAGCAGGAGAGAGGGGTGGG + Intergenic
913346118 1:117812828-117812850 CTGCTTCAGGAGAGAGAGCAAGG - Intergenic
914327524 1:146634911-146634933 CAGAACCATGAGTGGGAGGAAGG + Intergenic
914950630 1:152110653-152110675 CAGCTCCAGGAGGAGGAGGACGG - Exonic
915585845 1:156843533-156843555 CAACATCAGAAGAAGGAAGAAGG + Intronic
915597442 1:156903616-156903638 GAGCATCAGGAAGTGGAGGAGGG + Intronic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916794590 1:168154068-168154090 CAACAACAGTAAAGGGAGGAAGG - Intergenic
917119769 1:171635184-171635206 GAGCACCAGGAGATGGAGGTGGG + Intergenic
917186733 1:172364828-172364850 CAGTAGCAAGAGAGGGAGCAGGG - Intronic
917311775 1:173686115-173686137 CAGCCTGAGGAGAGTCAGGAGGG + Intergenic
917632558 1:176904457-176904479 CAGCATGGGGAGAGGGAGTGCGG + Intronic
917872842 1:179257128-179257150 CAGAATCAAGAGAAGTAGGATGG + Intergenic
918246257 1:182662243-182662265 CAGCACCAGAAGAGGGACTATGG - Intronic
918758363 1:188367831-188367853 CAGCAAAAGGAGGGGCAGGAAGG - Intergenic
919991041 1:202709020-202709042 CAGCAGTAGGGGAGGGAGAAGGG + Intronic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920350166 1:205332642-205332664 CAGCAGCAGGTGACGGGGGAGGG + Intergenic
920741139 1:208582319-208582341 CAGCATCTGGAGAGAGAAGATGG + Intergenic
921206294 1:212852308-212852330 AGGCAACAAGAGAGGGAGGAAGG + Intergenic
921247872 1:213264675-213264697 CATCATCAGGAAAGGGAAAAGGG + Intronic
921363435 1:214351617-214351639 CAGCAGCAGGCGAGGGAAGATGG + Exonic
921761892 1:218924319-218924341 TAGCACCCTGAGAGGGAGGAGGG - Intergenic
921897940 1:220420633-220420655 CAGAATCAGTACAGGTAGGATGG + Intergenic
921945406 1:220882766-220882788 AAGCAGCAGGAGGAGGAGGAAGG - Intronic
922027710 1:221767137-221767159 CAGGAGTAGGAGAGGCAGGAGGG - Intergenic
922191221 1:223320312-223320334 CATCATCAGGGGAGGGAAGGTGG + Intronic
922213268 1:223501218-223501240 GAGGAGGAGGAGAGGGAGGAGGG - Intergenic
922356291 1:224779521-224779543 CAGGAGCAGGAGAGAGAGGGTGG + Intergenic
922451095 1:225737937-225737959 CAGGACCAGGTGAAGGAGGAAGG - Intergenic
922790177 1:228306881-228306903 CAGCTGCAGGGGAGGGAGCAGGG - Exonic
922790192 1:228306930-228306952 CAGCACCAGGAGGTGGATGAGGG + Exonic
922912400 1:229228594-229228616 CAGCTTCAGGAGACTGAGGGGGG + Intergenic
923052010 1:230395846-230395868 GAGCATGAAGAGGGGGAGGAGGG - Intronic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923285782 1:232493589-232493611 CAGCATCCGGAGAGAGAAGGTGG - Exonic
924519738 1:244795611-244795633 CAGAAACAGGAGAGGGCAGAGGG - Intergenic
924876870 1:248115677-248115699 TGGCATCAGGAGACGGAGGCTGG + Intergenic
1063131471 10:3181546-3181568 CCGTATCAGGGGATGGAGGAAGG + Intergenic
1063922276 10:10944950-10944972 AGGCATCAGGAGAGGGGAGAAGG + Intergenic
1063929292 10:11013015-11013037 CAGGAAGAGGAGGGGGAGGATGG - Intronic
1064326508 10:14356180-14356202 TAGCATCAGGAGAGAGAAGGTGG + Intronic
1064839825 10:19578784-19578806 TACCATCAGAAGAGGAAGGAAGG - Intronic
1065830394 10:29609350-29609372 CAGCACCAGCAGAGGGTGGGAGG - Intronic
1065966968 10:30778662-30778684 AAGAATGAGGAGTGGGAGGATGG + Intergenic
1066004284 10:31133058-31133080 CAGCTCCTGGGGAGGGAGGAAGG - Intergenic
1066448496 10:35506562-35506584 CAGCATGAAGAAAGGGAAGAAGG - Intronic
1067040864 10:42952480-42952502 CCGGCTCAGGACAGGGAGGAGGG - Intergenic
1067681017 10:48441089-48441111 CCGCTCCAGGAGTGGGAGGAAGG + Intergenic
1067780812 10:49205459-49205481 GAGCTCAAGGAGAGGGAGGAAGG - Intergenic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1067876086 10:50009295-50009317 TAGCATGAGGAGAGGGGGGCGGG - Exonic
1067945708 10:50686837-50686859 CTGCATCAGGAGAGGGACCGAGG + Intergenic
1069593363 10:69655364-69655386 CACCAGGAGGTGAGGGAGGAAGG + Intergenic
1069862137 10:71478398-71478420 CATCATCAGGAGGCTGAGGAAGG - Intronic
1069879927 10:71585738-71585760 GAGCATCAGGAGAGGCCGGCTGG - Intronic
1069925810 10:71850180-71850202 CTGGATCTGGAGAGGAAGGAAGG - Intronic
1070393862 10:75994542-75994564 CGGGAGCAGGAGAGGGAGGCTGG + Intronic
1070867220 10:79713710-79713732 CTGCATCAGGAGAGGGACCGAGG + Intronic
1070881012 10:79851834-79851856 CTGCATCAGGAGAGGGACCGAGG + Intergenic
1071634134 10:87235934-87235956 CTGCATCAGGAGAGGGACCGAGG + Intronic
1071647584 10:87368151-87368173 CTGCATCAGGAGAGGGACCGAGG + Intronic
1072519521 10:96218775-96218797 CAGAAAGAGGAGGGGGAGGATGG - Intronic
1072563328 10:96596997-96597019 CAGGAGCAAGAGAGGGAGGCAGG + Intronic
1072712381 10:97724414-97724436 CAGGGCCACGAGAGGGAGGAGGG - Intergenic
1072792948 10:98332014-98332036 GAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1073991702 10:109268811-109268833 TAGCCTGAGGAGTGGGAGGATGG + Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1075053267 10:119199035-119199057 CTGCATCACAGGAGGGAGGAAGG - Intergenic
1075667323 10:124240523-124240545 CAGCAGCAGGAGATTGGGGATGG - Intergenic
1076221284 10:128734956-128734978 CAGGGTCAGAAGAGGGAGCACGG + Intergenic
1076240000 10:128897715-128897737 CAGAATCAGGTGGGGAAGGAAGG - Intergenic
1076278813 10:129227858-129227880 CAGCATCTTGAGAGGCAGAAAGG + Intergenic
1076279057 10:129229959-129229981 GAGCAGCAGGAGAGGCAAGAGGG - Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076806786 10:132862785-132862807 CAGGTTCAGGAGAGGCTGGAGGG + Intronic
1077061843 11:620992-621014 CAGGATCAGGAGAGGAAGGGCGG - Intronic
1077240639 11:1508722-1508744 CCACAGCAGGACAGGGAGGATGG - Intergenic
1078587083 11:12601156-12601178 CAGCATCAGGCAAGGGGAGAAGG - Intergenic
1079574560 11:21987277-21987299 CAGCATTTGGAAAGGGATGAGGG + Intergenic
1079742951 11:24086521-24086543 CAGTATCTGGAGGGGGAGGAGGG - Intergenic
1080312051 11:30905851-30905873 CAGGATTAGGGAAGGGAGGAGGG + Intronic
1082636449 11:55599982-55600004 CAGCATCAGGGGAGTGAAGCTGG + Intergenic
1083700872 11:64476985-64477007 CAGCCTCAGCAGAGGGGGGTAGG - Intergenic
1083995964 11:66272532-66272554 AAGCATCAGGAAAGAGAGGATGG - Intronic
1084085199 11:66851846-66851868 CAGCATCTGGAAAGGGATGTTGG + Exonic
1084165951 11:67374762-67374784 CAGCCCTTGGAGAGGGAGGAGGG - Intronic
1084738712 11:71123501-71123523 CATCATAAGGAGAGGGAGGGAGG + Intronic
1085024645 11:73229440-73229462 CAGGGTCAGGAGAGGCAGAAGGG + Intronic
1085242638 11:75071436-75071458 CACCAGCAGAAGGGGGAGGAAGG + Intergenic
1085410028 11:76285406-76285428 CAGCATGAGGAAAGGCAAGATGG - Intergenic
1085431543 11:76454918-76454940 CAGTATTAGGAGGGGGAGGAGGG - Intronic
1085525075 11:77159405-77159427 CAGCATCAGGGGAGGGAGGGTGG - Intronic
1085612051 11:77959454-77959476 CAGCATCAAGGGAGTGAGGATGG - Intronic
1085722189 11:78922246-78922268 CAGCATGAGGAAAGGCAGGCAGG + Intronic
1086809728 11:91293438-91293460 CAGCATCAGAAAAGGGGAGAGGG + Intergenic
1087594743 11:100238490-100238512 CAGCAGCAGGAGGAGGAGAAGGG + Intronic
1087653116 11:100891280-100891302 GAGCAACCGAAGAGGGAGGAGGG - Intronic
1088528904 11:110786718-110786740 CAGGAGCAAGAGGGGGAGGAAGG - Intergenic
1088757290 11:112896314-112896336 CAGGAGCAGGAGTGGGAGGTGGG - Intergenic
1089157484 11:116413660-116413682 CAACATCAGGAGAGAGGGGAGGG + Intergenic
1089437419 11:118482084-118482106 CAGAATCAGGTGAGTGAGGAGGG + Exonic
1089579440 11:119472268-119472290 CAGCATGAAGACAGGGAGGATGG - Intergenic
1089637956 11:119828475-119828497 AGGCATCAGGAGAGGGTGGCTGG + Intergenic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1089767145 11:120776293-120776315 CAGCCCCAGGAGCCGGAGGAAGG + Intronic
1090029445 11:123194914-123194936 TAGCAAGAGGAGAAGGAGGAGGG + Exonic
1090585336 11:128205996-128206018 GAGGAGCAAGAGAGGGAGGAGGG + Intergenic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1091128469 11:133123555-133123577 CAGCTTCAGGGGAGGGAGGTGGG - Intronic
1091662400 12:2394228-2394250 CCACATCAGGAGTAGGAGGAGGG - Intronic
1092275886 12:7060728-7060750 CAGAACCAGGACAGGGAGGCTGG + Intronic
1092529404 12:9332072-9332094 CAGCCTCAGGAGAGGCAGTGAGG - Intergenic
1092884843 12:12915941-12915963 CAGCCGCAGCAGTGGGAGGAGGG - Exonic
1092991768 12:13909823-13909845 AAGTATCAGGAAAGAGAGGAGGG + Intronic
1093016546 12:14161149-14161171 GAGGGTCAGGAGAGGGAGGGGGG + Intergenic
1093092638 12:14938505-14938527 CAGGAGCAGGAGAGGGACAATGG - Exonic
1093917660 12:24823686-24823708 CAGGAGGAGGAGAGGGAGGGTGG - Intronic
1094173725 12:27521292-27521314 CAGCCACAGGAGATGGGGGAGGG - Intergenic
1095311727 12:40706257-40706279 AAGCATCAGGGGAGGGGGGAGGG - Intronic
1095579070 12:43774779-43774801 CATCATCAGGAAAAGTAGGAGGG + Intronic
1095854409 12:46844447-46844469 TAGCATCAGGAGAGGCTGGAGGG + Intergenic
1096178411 12:49538151-49538173 TGGCACCAGGAGAGCGAGGAAGG - Intergenic
1096463551 12:51836170-51836192 TAGAACCAGGGGAGGGAGGATGG + Intergenic
1096528715 12:52230166-52230188 CAGCCTCAGGGGAGAGAGGCAGG + Intergenic
1096604939 12:52757933-52757955 GAGGGGCAGGAGAGGGAGGAGGG - Intergenic
1096752761 12:53772650-53772672 TGGCATCTGGAGAGGGAGGCTGG + Intergenic
1098028392 12:66230082-66230104 GAGCATCAGGGCAGGGAGGGAGG + Intronic
1099595020 12:84650743-84650765 CAACATAAGCAGAGGGAGCAGGG - Intergenic
1100052063 12:90460924-90460946 CAGGAGCAAGAGAGGAAGGAGGG + Intergenic
1100792254 12:98143404-98143426 CAGGAACTAGAGAGGGAGGAGGG + Intergenic
1101236765 12:102797564-102797586 GGGCATCAGGAGGGTGAGGAGGG + Intergenic
1101334710 12:103786228-103786250 CAGGATAAGGAGAGGAAGCAAGG + Intronic
1101535555 12:105613147-105613169 AGGCAGCAGGAGAGAGAGGAAGG - Intergenic
1102052163 12:109870626-109870648 AAGCAGAAGGAGAGGAAGGAAGG + Intronic
1102496087 12:113320527-113320549 AAGCAGCAGGAGAGGGTGCAGGG - Intronic
1102965925 12:117125308-117125330 GAGCACCAAGAGAGCGAGGAAGG - Intergenic
1103620816 12:122186140-122186162 CTGTAGCAGGAGAGGGAGCACGG - Intronic
1104381679 12:128312996-128313018 TTCCATGAGGAGAGGGAGGATGG - Intronic
1104933789 12:132353950-132353972 CATCATCTGGAGAGACAGGAAGG + Intergenic
1105325157 13:19364176-19364198 CAGCCTCAGGAGACTGAGGTGGG + Intergenic
1105531456 13:21224474-21224496 CAGCAGCAAGAGATGGAAGAAGG + Intergenic
1105546028 13:21351844-21351866 CAGCATCTGGAGAGGATGGCTGG + Intergenic
1105705737 13:22966467-22966489 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1105858640 13:24391452-24391474 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1107015476 13:35705310-35705332 GGGCATGAGTAGAGGGAGGAAGG + Intergenic
1107062075 13:36170346-36170368 CAGCATGAGGAGCGAGAGCATGG + Intronic
1107246752 13:38306032-38306054 CAGCAGCATGAGAGAGAGCAGGG + Intergenic
1108533505 13:51348373-51348395 CAGCCTGAGGAGAGCCAGGATGG + Exonic
1110461402 13:75749576-75749598 CAGCAGCAGGTCAGGGAGGGAGG - Intronic
1110619394 13:77578319-77578341 CACCACCAAGAAAGGGAGGAGGG + Intronic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1111577755 13:90180410-90180432 CAGCAACAGGACAGCGAGGTGGG - Intergenic
1111774282 13:92640006-92640028 CAGAATTAGGAGAGGGAGAAGGG - Intronic
1112214707 13:97418350-97418372 AAAGATCAGGAGAGGGATGATGG - Intergenic
1113397398 13:109961340-109961362 CAGCATCAGGAGATGGACAGAGG - Intergenic
1113574935 13:111388660-111388682 GACAATGAGGAGAGGGAGGAGGG - Intergenic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1114675978 14:24440571-24440593 CAGCATGGGGAGAGTGAGGAAGG - Exonic
1115653033 14:35416948-35416970 CAGAGTCAGGAGTGGGAAGAAGG + Intergenic
1116773260 14:49151399-49151421 AAGCAGCTGGAGAAGGAGGAAGG - Intergenic
1117253170 14:53954811-53954833 CAGCCTCAGGAAAGGGAGGTCGG - Intronic
1117964134 14:61189524-61189546 CAGAAGCAAGAGAGAGAGGAAGG - Intronic
1118335051 14:64846279-64846301 AAACATCAGGAGGGGTAGGAGGG + Intronic
1118720617 14:68591175-68591197 CAGCAACAGGAGAGTGAGTTGGG + Intronic
1118764353 14:68899959-68899981 CAGCAGCAGGAGATGTGGGAAGG + Intronic
1118920996 14:70149878-70149900 CAGCCCCAGGACAGGGAAGAAGG - Intronic
1119415608 14:74467435-74467457 CAGCCCCAGGAGAGGGGGCAGGG + Intergenic
1119537061 14:75411113-75411135 CAGCATCAAGGCAGGGTGGAAGG - Intergenic
1119601611 14:75980625-75980647 ATGCATGGGGAGAGGGAGGAAGG - Exonic
1119957055 14:78809710-78809732 CAACCTAAGGAGAGGGTGGAGGG + Intronic
1120917290 14:89721250-89721272 CAGCTTAAGGAGAGGGGAGAGGG - Intergenic
1120940076 14:89939488-89939510 CAGCAACAGGAGCAGGAGGCGGG + Intronic
1121240437 14:92426064-92426086 CAGCATCAGGGCAGGGAGAGAGG + Intronic
1121586654 14:95067577-95067599 CAGCAGCATGAGGGGGAGGGTGG + Intergenic
1122183708 14:99972755-99972777 CAGGATCTGGAGAGGAAGGGAGG - Intronic
1122812088 14:104294062-104294084 CAGCCTCAGGACAGGGAGCACGG - Intergenic
1123144293 14:106112990-106113012 ATGCATCAGGGGTGGGAGGAAGG + Intergenic
1123786079 15:23674963-23674985 CAGAACCAGGAGAGAGAGGAAGG - Intergenic
1124192032 15:27587875-27587897 CAGGATTCGGAGAGGGCGGAGGG + Intergenic
1124866143 15:33493213-33493235 AAGCATCGGCAGGGGGAGGAAGG - Intronic
1125525408 15:40370931-40370953 GTGCAGCAGGAGAAGGAGGATGG + Exonic
1125611816 15:40976526-40976548 CAGCCTCAGGGGAAGAAGGAAGG - Intergenic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1125923058 15:43537969-43537991 CAGAAACAGAAGAGGGAGAAGGG + Intronic
1126339447 15:47623060-47623082 GGGCTTCAGGAGAGGGAGGGGGG - Intronic
1126403190 15:48295414-48295436 CAGCAACAGGACAGAAAGGATGG - Intronic
1126671640 15:51120820-51120842 CTGCATCAGGAGAGGAGGGTGGG + Intergenic
1126758340 15:51946299-51946321 CAGCCTCAGGAGACTGAGGCAGG - Intronic
1126907465 15:53383525-53383547 CAGAAGCAAGAGAGAGAGGAGGG + Intergenic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127282361 15:57503227-57503249 CCTCATCAGGAGTAGGAGGAAGG - Intronic
1127329286 15:57922974-57922996 CAGGATCAGCTCAGGGAGGAGGG + Intergenic
1127388449 15:58486251-58486273 CAGCCTGAGGAGATGGGGGAGGG - Intronic
1127396904 15:58550368-58550390 AAGCATCAAGAGAAGGAAGAAGG + Intronic
1128842323 15:70860182-70860204 CAGCCGCAGGAGGGGTAGGATGG - Intronic
1128865955 15:71115417-71115439 CCGCAAGAGGGGAGGGAGGAAGG + Exonic
1129093762 15:73181608-73181630 CAGGATCAGGAGAGTGAGGTGGG + Intronic
1129163159 15:73758898-73758920 CAGCAGCCAGAGAGGCAGGAAGG - Intergenic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129301825 15:74629897-74629919 CCGCATGAGGAGATGGAGGGCGG + Exonic
1129756910 15:78104247-78104269 CAGGGTCAGGGCAGGGAGGAGGG - Exonic
1129882571 15:79016922-79016944 CAGCAGAAGGGGAGGGAGGTTGG - Intronic
1129927935 15:79382765-79382787 CAGGATGAGGAGTGGCAGGAAGG - Intronic
1130379721 15:83360986-83361008 GGGCAGCAGGAGAGGGAAGAAGG - Intergenic
1130894913 15:88162460-88162482 CAGCAGAAGGAGAGGGGAGAAGG + Intronic
1130897298 15:88181450-88181472 CAGGCTCAGGAGTGGGAGCAGGG - Intronic
1131151195 15:90048421-90048443 TGGCATCAGCACAGGGAGGAGGG + Intronic
1131271472 15:90950042-90950064 AAGCCTGGGGAGAGGGAGGAAGG + Intronic
1131424193 15:92332114-92332136 CAGCCTGAAGGGAGGGAGGAGGG - Intergenic
1131703649 15:94969168-94969190 CAGGATAAGGAGAGGGAGCTGGG + Intergenic
1131728371 15:95251981-95252003 TGGCATGAGGAGAGGTAGGAGGG + Intergenic
1131909116 15:97177278-97177300 CAGCCACAGGAGAGGGAACAAGG - Intergenic
1134122798 16:11596693-11596715 GAGCAGGGGGAGAGGGAGGAGGG + Intronic
1135721627 16:24822772-24822794 GAGCCTCAGGAAAGAGAGGAGGG + Intronic
1135815341 16:25627463-25627485 CAGGAGCAAGAGAGGGAGGGAGG + Intergenic
1135874061 16:26181015-26181037 CAGCATCAAGAGAGGGTGCGAGG + Intergenic
1135892127 16:26366665-26366687 AAGCAGAGGGAGAGGGAGGAGGG + Intergenic
1136025318 16:27464802-27464824 CAGCATCAGGTGCTGGAGGTCGG - Exonic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1136501795 16:30674425-30674447 CTGCATCAAGTGAGGGAAGAGGG - Intergenic
1136542715 16:30937304-30937326 CAGCAAGGGGAGGGGGAGGAGGG - Intronic
1136550446 16:30979846-30979868 CTGCAGCAGCAGCGGGAGGAGGG + Exonic
1136776204 16:32873135-32873157 CAGCTGCAGGCCAGGGAGGAAGG - Intergenic
1136785571 16:32932173-32932195 CAGCGTGAGGAGAGGTAGAAGGG + Intergenic
1136894411 16:33988377-33988399 CAGCTGCAGGCCAGGGAGGAAGG + Intergenic
1137872645 16:51965301-51965323 CATCTTCAGAAGAGGTAGGAGGG + Intergenic
1138119888 16:54391555-54391577 CAGCATGAGGAGAGTGATTAAGG + Intergenic
1138234499 16:55370558-55370580 CAGCCGCTGGAGAAGGAGGAAGG - Intergenic
1138541413 16:57689894-57689916 CAGCATCCGGACGGGGAGGTGGG - Intergenic
1139283493 16:65789778-65789800 AGGCATCTGGAGAGGGGGGATGG + Intergenic
1139328467 16:66169600-66169622 GAGGAGGAGGAGAGGGAGGAAGG + Intergenic
1139673815 16:68509565-68509587 CAGCACCCGGAGAGGGACCAAGG - Intergenic
1140006037 16:71076029-71076051 CAGAACCATGAGTGGGAGGAAGG - Intronic
1140094704 16:71864837-71864859 CAGCATCAGGGCAGGCAGAAGGG + Intronic
1140213106 16:72986215-72986237 CAACTTCAGGAAGGGGAGGACGG + Intronic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140775838 16:78248275-78248297 CAGGAGCAAGAGAGGGAGCAAGG + Intronic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141635987 16:85314154-85314176 CTGCCTCAGGGGAGGGAGGCTGG - Intergenic
1141868898 16:86770952-86770974 CTGCAACAGGAAAGGGAAGAAGG - Intergenic
1142024448 16:87804943-87804965 CAGCATGTGGAGAGAGAGGGCGG + Intergenic
1142160083 16:88552829-88552851 CAGGAGCTGGAGAGGCAGGAAGG + Intergenic
1142367456 16:89657606-89657628 CAGCACTCGGAGAGGGAGAAGGG + Exonic
1203078619 16_KI270728v1_random:1135244-1135266 CAGCTGCAGGCCAGGGAGGAAGG - Intergenic
1142478265 17:202502-202524 CAGCAGCAAGAGAGTGAGGCGGG + Intergenic
1142867523 17:2799765-2799787 CTGCCTCTGGAGAGGGAGGAGGG + Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1143007632 17:3847116-3847138 AAGAAAGAGGAGAGGGAGGAAGG - Intergenic
1143043856 17:4060631-4060653 TGGCATCAGGAGAAGCAGGAAGG - Intronic
1143119131 17:4596470-4596492 CAGAAGGAGGAGTGGGAGGAAGG + Intronic
1143267682 17:5652718-5652740 CAGTATATGGGGAGGGAGGAAGG + Intergenic
1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG + Intronic
1144727830 17:17510801-17510823 CAGCGTAAGGAGAGCCAGGATGG - Intronic
1145001539 17:19308548-19308570 CAGCATCAGGATGGAGGGGAAGG + Intronic
1145212990 17:21028940-21028962 CAGGATCAGGAGCAGGAGGTGGG - Intronic
1145260550 17:21352106-21352128 CCAAGTCAGGAGAGGGAGGAGGG + Intergenic
1145975005 17:28978813-28978835 CATCATCAGGGGAGGGATGGTGG + Intronic
1146234957 17:31150620-31150642 CAAAATGAGGAGAGGGAGGGTGG - Intronic
1146501918 17:33372075-33372097 CAGCTTCAGGAGAGGCAGAGAGG - Intronic
1146578044 17:34012046-34012068 CAAAATAAGGGGAGGGAGGAAGG - Intronic
1148647011 17:49225024-49225046 CAGCAGGAGGAGGAGGAGGAGGG + Exonic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148964706 17:51425217-51425239 GAGCACCCTGAGAGGGAGGAAGG - Intergenic
1149376982 17:56054005-56054027 GAGAATCAGAAGAGGGAGGGAGG - Intergenic
1149479094 17:56987042-56987064 CAGCATCAGGACTGGGACCATGG - Intronic
1149509970 17:57232297-57232319 CAGGGTGAGGAGAGGCAGGATGG + Intergenic
1149570181 17:57666795-57666817 CAGCAACATGAGAGGGTGGCTGG + Intronic
1150286237 17:63955829-63955851 CAGCACCAAGAGAGGGAAGGGGG - Intronic
1150590362 17:66556941-66556963 CAGCATCAGGATAGGGGATAAGG + Intronic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1151111403 17:71682343-71682365 CAGCAGTAGGATAGGGAAGAAGG - Intergenic
1151345146 17:73496830-73496852 GACCTTCAGGAGGGGGAGGATGG - Intronic
1152266277 17:79296837-79296859 AAGCAGGAGGAGGGGGAGGAGGG - Intronic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1152671844 17:81612937-81612959 CAGCTGCAGGGGAGGGAGGAGGG - Intronic
1152876640 17:82790206-82790228 CAGCCACAGGAGAGGCGGGAGGG - Intronic
1152962135 18:86384-86406 CTTCATCAGGTGAGGGTGGAGGG - Intergenic
1153520911 18:5953168-5953190 GAGCATCAGGAGAAGGGGAAGGG + Intergenic
1153577706 18:6539335-6539357 CAGAGCCAGGAGAGAGAGGAGGG + Intronic
1153630131 18:7061655-7061677 CCACATCAGAAGAGGAAGGAAGG - Intronic
1153749155 18:8211309-8211331 CAGCATCAGAACAGGGTGGAAGG + Intronic
1153796392 18:8626758-8626780 GAGAATCAGGAGAGGGAGAGGGG - Intronic
1156131752 18:33984590-33984612 CAGGAGCAAGAGAGAGAGGAGGG - Intronic
1156318129 18:35990445-35990467 CTGCATCTGGACAGGGAGGTTGG + Exonic
1156461903 18:37326020-37326042 AAGGACCAGGGGAGGGAGGAAGG - Intronic
1156658265 18:39313457-39313479 CAGCAAGAGGAGAGGGGAGAAGG - Intergenic
1156812666 18:41271789-41271811 CAGAAGCAAGAGAGGGAGGTGGG - Intergenic
1157407902 18:47438816-47438838 CAGGAGCAGGAGAGTGAGGCAGG - Intergenic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1157488609 18:48107167-48107189 AACCGTCAGGAGAGGGAGGAAGG + Intronic
1157488680 18:48107420-48107442 GAGGAAGAGGAGAGGGAGGAGGG + Intronic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1157718720 18:49907132-49907154 GAGGATCAGGAGAGCCAGGATGG + Intronic
1157818489 18:50748504-50748526 GAGCCCCAGGAGAGGGAGGCAGG - Intergenic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158124840 18:54089916-54089938 TAGCAACAGGCGAGGGAGGTGGG + Intergenic
1158387529 18:57012358-57012380 CAGCACCAGGATAGGAAGGGAGG + Intronic
1158404904 18:57152282-57152304 CAGAATCAGAAGAGGGAGAATGG + Intergenic
1158722195 18:59935434-59935456 CAGCATTAGGAGCAGGATGAAGG - Intergenic
1158849590 18:61482093-61482115 CAGCACCAGGACAGGGAAGCTGG + Intronic
1159576320 18:70182482-70182504 CAGCAAAAGGGAAGGGAGGAAGG + Intronic
1159995801 18:74962677-74962699 CAGCACCAGGAGAGGGAAGAGGG - Intronic
1160072891 18:75643676-75643698 CAGCAGCAGGTGAGGGAGCCAGG - Intergenic
1160689497 19:454877-454899 CAGCACTGGGAGAGGCAGGACGG - Intronic
1160699542 19:499137-499159 CAGAATGAGGAGGGGGAGAAAGG - Intronic
1160918048 19:1507031-1507053 GAGCATCAGAGGAGGGAGGCTGG - Intronic
1160975796 19:1791856-1791878 CAGCAGCTGGTGGGGGAGGAGGG + Exonic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161381658 19:3968664-3968686 AAGCATGAGAAGGGGGAGGAGGG + Intronic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161746105 19:6061131-6061153 TAGCAGCAGGAGCGGAAGGAAGG - Intronic
1161845016 19:6707378-6707400 CAGGAGCCAGAGAGGGAGGAGGG - Intronic
1163516273 19:17765786-17765808 CAGCAGGAGGAGAAGGTGGAGGG + Intronic
1164236958 19:23345854-23345876 AAGCCTCAGGAGAGGGCGGTGGG - Intronic
1164539965 19:29115065-29115087 AAGAAGCAGGAGAGGAAGGAAGG - Intergenic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165631233 19:37304117-37304139 CAGCCTCAGGAGTGCGCGGACGG - Intergenic
1165751574 19:38263812-38263834 CAGCATCAGAATTGAGAGGAAGG - Intronic
1166017631 19:39994857-39994879 CAGGAGCAAGAGAGTGAGGAGGG - Intronic
1166235958 19:41456805-41456827 CAGCATCTCGAGATGGAGCAGGG + Intergenic
1166325870 19:42050866-42050888 CAAGCTCAGGAGAGGGAGGGAGG + Intronic
1166496698 19:43307998-43308020 CAGCTCCATGGGAGGGAGGAAGG + Intergenic
1166643558 19:44514355-44514377 AAGGATCAGGAGGGTGAGGAAGG + Intronic
1166818311 19:45560504-45560526 AAGCATCAGGAGAGAGAGAAGGG - Intronic
1166886082 19:45961809-45961831 GATCATCAGGATATGGAGGAAGG + Intronic
1166894750 19:46016403-46016425 CAGGGGCAGGTGAGGGAGGAAGG - Intronic
1167740276 19:51320439-51320461 CACCAGGCGGAGAGGGAGGAAGG - Intronic
1168264423 19:55214355-55214377 CAGGAGCAAGAGAGAGAGGACGG + Intergenic
1168515647 19:57008545-57008567 TAGAGTCAGGTGAGGGAGGATGG + Intergenic
1168660642 19:58163162-58163184 CAGGGTCGGGAGAGGGGGGAGGG + Intergenic
925135210 2:1522043-1522065 TGGGGTCAGGAGAGGGAGGAAGG - Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
926230970 2:11003544-11003566 CAGAACCTGGAGAGGCAGGAAGG + Intergenic
926268757 2:11348714-11348736 AAGCATCAGGAGGGCTAGGAAGG - Intergenic
926378943 2:12264723-12264745 CAGGAGCAAGAGAGCGAGGAAGG + Intergenic
926418151 2:12671144-12671166 CTGAATCAGGAGTGGGAGGATGG - Intergenic
926421012 2:12699392-12699414 GAGGATCAGGAGAAGGAGAAGGG + Intergenic
926547558 2:14260634-14260656 CAGCTTGAGGAAAGGGATGAGGG + Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927508569 2:23630144-23630166 CAGCACCAGGAGTGGGAGCCAGG + Intronic
928051531 2:28001739-28001761 CAGGAGCAAGAGAGAGAGGAGGG + Intronic
928285671 2:29988080-29988102 CAGCAGTAGGGGAGTGAGGAAGG - Intergenic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
928697058 2:33859985-33860007 CAGCCGCAGGAGGGGAAGGAAGG - Intergenic
929043849 2:37772112-37772134 CAGCTTCAGGACAGAGAGGCTGG - Intergenic
929565394 2:42980656-42980678 TGGCATCAGGAGAGAGAGGGAGG + Intergenic
929907673 2:46060640-46060662 CAGCAACGGGAAGGGGAGGAGGG - Intronic
929979171 2:46662938-46662960 CAGCCTCAGGAGAGCCAGGATGG + Intergenic
930023623 2:47016318-47016340 CAGCATCAGGAGACTGGGGTTGG + Intronic
931426794 2:62178756-62178778 CAGCAGCAGGAGAGTAAGGGAGG + Intergenic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
932925987 2:75975133-75975155 AATCATCAGCAGAGGGAAGAGGG + Intergenic
933024937 2:77244582-77244604 AAGTATCAGGAGGGGGTGGAGGG - Intronic
933033264 2:77359480-77359502 AATGATCAGGAGATGGAGGAGGG - Intronic
933244245 2:79957388-79957410 CACCAGCAGGAGATGGAGGAGGG + Intronic
933267725 2:80200378-80200400 CAGCATAATGATAGTGAGGAAGG - Intronic
933721082 2:85398206-85398228 CAGCCTGAGGAGGGGGAGGCTGG + Intronic
934906960 2:98213454-98213476 GAGCAGCAGGAATGGGAGGAGGG + Intronic
935146171 2:100397057-100397079 CAGCATCAGGAGTGGCAAGCAGG + Intronic
935632693 2:105224860-105224882 CAGCAGCACGAGGAGGAGGAGGG - Intergenic
935740191 2:106140548-106140570 GGGCACCAGGAGAGGGAAGATGG - Intronic
936092898 2:109512327-109512349 GGGCATCAGAAGAAGGAGGAAGG - Intergenic
936611758 2:114008537-114008559 CAGAATCAGGGAAGGGAAGAAGG + Intergenic
936720998 2:115253156-115253178 CAGGAGCAGGAGAGGGAGTGGGG + Intronic
937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG + Intergenic
937927613 2:127179228-127179250 CAGACTCTGGAGATGGAGGAAGG - Intergenic
938114043 2:128591388-128591410 CAGCAACAGGGGAGGAAGGCAGG - Intergenic
938201907 2:129379161-129379183 CAGTATCAGGACTGGAAGGAGGG + Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
940148872 2:150577621-150577643 CAGCAGGAAGAGAGAGAGGAGGG + Intergenic
941319633 2:164038985-164039007 CAGGAGCAAGAGAGGGAGGGTGG + Intergenic
942452169 2:176115072-176115094 CTGCAGCAAGAGAGGGAGGGAGG + Intronic
942490442 2:176484500-176484522 AAGCCTCAGGAGAGGGAGGGAGG - Intergenic
942994920 2:182249380-182249402 CAGTATCTGGAGGGGGAAGAGGG + Intronic
943060950 2:183040775-183040797 AAGGAGGAGGAGAGGGAGGAGGG + Intergenic
943238638 2:185356129-185356151 CAGGAGCAAGAGAGGGAGGCAGG - Intergenic
943676568 2:190721556-190721578 CAGCTCCAGGACAGGAAGGAGGG - Intergenic
943685474 2:190813226-190813248 CAACAGCAGGAGAGTGAGGATGG + Intergenic
943810343 2:192179663-192179685 CAGGATCTGGAGATGGAGGTAGG - Exonic
944037477 2:195312845-195312867 GAGCAAGAGGAAAGGGAGGAGGG + Intergenic
944315244 2:198277733-198277755 CAGGATCTGGAGCAGGAGGAGGG - Intronic
944496788 2:200315346-200315368 CATCATCAGAAGTGGGAGGCAGG + Intronic
944499369 2:200342456-200342478 CAGCATCAGACGGAGGAGGAAGG - Intronic
944534370 2:200695100-200695122 CAGGAGCAAGGGAGGGAGGAGGG - Intergenic
944975286 2:205042826-205042848 ATGCATCAGGACAGGGAGAAGGG - Intronic
945298707 2:208195945-208195967 CACCATCAGGACATGGAGAATGG + Intergenic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
947544617 2:231002022-231002044 CAGAATCAGGAAAGTGAGCAGGG + Intronic
947564978 2:231187968-231187990 AGCCATCAGGAGAGGGAGGAGGG + Intergenic
948031281 2:234819662-234819684 CAGCATGTGGGAAGGGAGGAGGG - Intergenic
948056237 2:235011004-235011026 GGGTTTCAGGAGAGGGAGGAAGG - Intronic
948338750 2:237232154-237232176 AAGCATCTGGAGAGGGAGAGGGG - Intergenic
948384778 2:237574709-237574731 CAGCCTCTGGACAGAGAGGAAGG - Exonic
948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG + Intronic
948806381 2:240455086-240455108 CAGGATCGGGAGGGGGAAGATGG + Intronic
948917008 2:241039521-241039543 CAGCATCCGGTGAGGAGGGAGGG + Intronic
948981133 2:241495420-241495442 CTGGGCCAGGAGAGGGAGGAGGG + Exonic
948995467 2:241576129-241576151 CGGGAGGAGGAGAGGGAGGAAGG - Intergenic
949028261 2:241776383-241776405 CAGGCTCAGGAGGAGGAGGAGGG + Intergenic
1168889623 20:1286402-1286424 CTGCAGCTGGAGAGGGAGAAGGG + Intronic
1168943921 20:1735883-1735905 CCGCAGCAGGAGAGGGAGGGAGG - Intergenic
1169192554 20:3667389-3667411 CAGAATCAGGAGCGAGTGGAAGG - Intergenic
1170014792 20:11768497-11768519 CAGGAACAGGAGAGAGAAGAGGG + Intergenic
1170220906 20:13940630-13940652 CAGCATCATGAGTGGGAGCAGGG + Intronic
1170317895 20:15062202-15062224 CAGCCTCAGGAGAAAGAGGCTGG + Intronic
1171208832 20:23301600-23301622 GAACATCTGGAGAGGGAGCAGGG + Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171941186 20:31331312-31331334 GAGGAGCAGGAGAAGGAGGAGGG + Intergenic
1172105936 20:32517354-32517376 CAGCAGCTGGAGAGGGAGAAGGG + Intronic
1172598339 20:36166058-36166080 AATCATCAGGAGAGGCAGGCTGG + Intronic
1172598741 20:36168891-36168913 CACCATCCTGAGAGGGAGGGAGG + Intronic
1172754989 20:37277202-37277224 CATCATCACGTGAGGAAGGAGGG + Intergenic
1172982387 20:38953720-38953742 CTAAGTCAGGAGAGGGAGGAAGG - Intergenic
1173098266 20:40059370-40059392 CAGCAGCAAGAGAGAGAGAAAGG - Intergenic
1173324927 20:42024458-42024480 CAGCATCAGGAGAGAAAGCATGG - Intergenic
1173501857 20:43559675-43559697 CAGCAGCAGGAGAGGGTGCATGG + Intronic
1173619800 20:44428368-44428390 CTGCATCAGGTGAGGGTGCAGGG - Exonic
1173871423 20:46344420-46344442 TAGCATGAGGAGGGGGAAGAGGG - Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174729781 20:52904580-52904602 AAACATTGGGAGAGGGAGGAGGG + Intergenic
1174808256 20:53623534-53623556 CAGCACGAGGAGGAGGAGGAGGG - Intergenic
1175056275 20:56201496-56201518 CATCATGGGGAGAGGGAGGAAGG + Intergenic
1175061696 20:56249302-56249324 CAGCATCATGACCGTGAGGAAGG + Exonic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175319343 20:58074399-58074421 AAGCAGAAAGAGAGGGAGGAGGG + Intergenic
1175779670 20:61674369-61674391 CAGCATCAGGCTAAGGAGGGTGG + Intronic
1175983448 20:62752791-62752813 CAGCAGCCGGAGTGGGAAGAGGG + Intronic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1176216207 20:63949135-63949157 CACCATCAGGGGAGTGAGCACGG + Intronic
1176289869 21:5038099-5038121 CAGCATGGGGAGTGGGAGGGGGG - Intronic
1177012863 21:15750088-15750110 CAGCATCCGGGGAGGGAAGAGGG + Intronic
1178358853 21:31931709-31931731 AGGCATCAGGAGAGGAGGGAAGG - Intronic
1178784184 21:35637268-35637290 CAGCATCTAAAGAGGGAGAAAGG + Intronic
1179008497 21:37534780-37534802 CTGCATCAGCAAAGGTAGGAAGG + Intergenic
1179238548 21:39568387-39568409 AAGCAGCTGGAGAGGCAGGAGGG - Intronic
1179378172 21:40870818-40870840 AAGCCTCAGGGGAGGGAGGTTGG + Intergenic
1179570668 21:42276910-42276932 AAGCTTCAGGAGAAGGATGAAGG + Exonic
1179802146 21:43816186-43816208 CCTCAGCAGGAGAGGGAGGCAGG - Intergenic
1179867382 21:44225540-44225562 CAGCATGGGGAGTGGGAGGGGGG + Intronic
1179903479 21:44406947-44406969 CCCCACCAGGGGAGGGAGGAGGG + Intronic
1180151054 21:45948116-45948138 CAGCCTCAGGAGAGGGGCTAGGG - Intergenic
1180863897 22:19104887-19104909 CAGCAGCAGCAGAGGGGAGAAGG + Intronic
1181304864 22:21909997-21910019 CAGCATCAACAAAGGCAGGATGG - Intergenic
1181334993 22:22122897-22122919 GAGCAGCAGGAGAGGGGAGAAGG - Intergenic
1181619460 22:24078831-24078853 CAGCTTCAAGAGAGTGAGGGAGG - Intronic
1181683744 22:24514479-24514501 CAGGATCAGGAGGAGGTGGAAGG + Intronic
1181920641 22:26317804-26317826 GAGTATCAGGGCAGGGAGGAAGG - Intronic
1182126069 22:27816756-27816778 AAGGATCAGAAGAGGGAGGAGGG - Intergenic
1182372287 22:29819720-29819742 CAGCAGCAGGAGACGGGGGAGGG - Intronic
1182460748 22:30481885-30481907 CAGCAGCAGGAGCAGGAGGGCGG + Intergenic
1182573142 22:31254173-31254195 CAGGCCCAGGAGAGGGAGCAGGG - Intronic
1183248546 22:36712032-36712054 CAGGATGGGGAGAGGGCGGAGGG + Intergenic
1183419772 22:37704727-37704749 CAGGAAGAGGAGAGGAAGGAAGG + Intronic
1183475902 22:38035632-38035654 CAGCACCTGGAGAGTGAGGTGGG - Intronic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183714591 22:39526333-39526355 CAGCTTCAGAAGAGAGAGCAGGG + Intergenic
1183785162 22:40025000-40025022 CAGCAGGAGGCGAGGGCGGAGGG - Intronic
1184011245 22:41750260-41750282 GAGCATTTGGAGAGGTAGGAAGG + Intronic
1184314362 22:43672703-43672725 CACCCTCAGGAGAATGAGGATGG + Intronic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1184652600 22:45925968-45925990 CAGGGACAGGGGAGGGAGGAGGG - Intronic
1185133245 22:49052434-49052456 CAGCACCACGGGAGGGAGGGCGG + Intergenic
1185148000 22:49149741-49149763 GAGAAGCAGGGGAGGGAGGAAGG + Intergenic
1185261349 22:49865956-49865978 CAGCATCGGGAGGTGGAGGCGGG - Intronic
1185385736 22:50530663-50530685 CAGAGTCAGGAGAGTGGGGAGGG - Intronic
949221169 3:1635800-1635822 AAGCTTCAGATGAGGGAGGAGGG + Intergenic
949927757 3:9055548-9055570 CAGCTGCAGGGGAGGGAGGCTGG + Intronic
950104173 3:10377821-10377843 CAGCAGCTGGAGAGGGTGCAGGG - Intronic
950464832 3:13147317-13147339 CAGACTCAGAAGAGGGAGGGTGG - Intergenic
950543275 3:13624856-13624878 CAGCACCAGGAGGGGGTAGATGG + Intronic
950579699 3:13854135-13854157 AAGCCTGAGAAGAGGGAGGAAGG + Intronic
952075647 3:29694123-29694145 CAGCCTCTGGAGAGTGAGGCAGG + Intronic
952190243 3:31015306-31015328 AAGCAGCATGAGAGGGAGAATGG - Intergenic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952505643 3:34004676-34004698 TGACATCAGGAGAGGGAGGTAGG + Intergenic
952755699 3:36864631-36864653 CAGAATCAGGGGAGGGTGGAGGG - Intronic
953091153 3:39727184-39727206 CAGTAGCAAGAGAGTGAGGATGG + Intergenic
953213980 3:40900781-40900803 TAGCATGAGGAGAGTGAGGTAGG + Intergenic
953347049 3:42184979-42185001 CAGCAGCAGGAGCTGCAGGAAGG - Intronic
953404244 3:42652767-42652789 CAGCATCAGGAGCCAGGGGAAGG - Intergenic
953415368 3:42712600-42712622 CAGCAGCAGGAAGGGGAGAAGGG - Intronic
954446740 3:50550871-50550893 CACCAGCAGGAGAGCCAGGATGG - Intergenic
954618678 3:51983572-51983594 CAGCGACAGGAGAGTGAGGTGGG + Exonic
955068765 3:55554907-55554929 CAGCCTCTGGAAAGGAAGGAGGG + Intronic
955084641 3:55690919-55690941 GAGCTACAGGAGAGGGAGGGAGG - Intronic
955358349 3:58250556-58250578 CAGAAACAGGAGGGAGAGGAAGG + Intronic
955628779 3:60949577-60949599 CAGCGACAGGATAGGGAGGAGGG - Intronic
956295941 3:67713785-67713807 GAGCAACAGGAGAGAGAGGGAGG - Intergenic
956935541 3:74096640-74096662 CAGCATGGGGGGAGGGAGCATGG + Intergenic
958524248 3:95233366-95233388 CAGCAGTAGGAGAGAAAGGAAGG - Intergenic
959385525 3:105701028-105701050 CTCCATCAGCAGAGGGAAGATGG + Intronic
960190401 3:114697734-114697756 AAGGAGCAGGAGAGGGAGGGAGG + Intronic
960338337 3:116445530-116445552 GAGAAACAGGAAAGGGAGGAGGG - Exonic
960458127 3:117899187-117899209 CAGCCTCTGGGGAGAGAGGAAGG + Intergenic
960724878 3:120660063-120660085 CAGGAGCAAGAGAGAGAGGAGGG - Intronic
961213530 3:125142907-125142929 CAGAGTCAGGGAAGGGAGGAGGG - Intronic
961222693 3:125212686-125212708 CAGGAGCAGGTGAGGGCGGAAGG - Intronic
961467447 3:127090356-127090378 CAGTCTCCTGAGAGGGAGGAGGG - Intergenic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
961683341 3:128613484-128613506 CAGCCTCAGTGGAGGGAGGGAGG - Intergenic
962049750 3:131800601-131800623 CAACATCAGGAGCAGTAGGAGGG - Intronic
962475703 3:135753233-135753255 CAAGAGCAGGAGAGGCAGGACGG + Intergenic
963000580 3:140678121-140678143 CGGCCTCAGGAATGGGAGGAAGG + Exonic
964130249 3:153279009-153279031 CAGTTTCAAGAGAGGGAGGAGGG - Intergenic
964490145 3:157227574-157227596 CAGGAGCAAGAGAGTGAGGAGGG + Intergenic
965587013 3:170327703-170327725 CAGGAGCAGGAGCGGGAGGTGGG - Intergenic
966205125 3:177398319-177398341 CAGAAGCAGGAGAGAGGGGAGGG + Intergenic
966470488 3:180283402-180283424 CAGGATCAGGGCAAGGAGGAGGG + Intergenic
966908573 3:184544755-184544777 GAGGAGGAGGAGAGGGAGGAGGG - Intronic
967550739 3:190792386-190792408 GAGAAGCAGGAGAGAGAGGAAGG + Intergenic
967686928 3:192428326-192428348 AAGAATCAGGAGAGGAAGAAGGG + Intronic
967717754 3:192782733-192782755 TAGCAACAGGAGAGTGTGGAAGG - Intergenic
967862687 3:194163923-194163945 CAGGAGGAGGAAAGGGAGGAGGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968903590 4:3442054-3442076 CAGCAGGAGGAGGAGGAGGAAGG - Exonic
969433837 4:7172585-7172607 CAGCCTCAGGAAAGGGATGCAGG - Intergenic
969476985 4:7427427-7427449 GAGCTTCAGCAGTGGGAGGATGG + Intronic
969563108 4:7961905-7961927 CAGCATGAGGAGAGGGATCATGG - Intergenic
969689714 4:8697855-8697877 CAGGAGCAGGAGAAGCAGGAAGG - Intergenic
969695187 4:8730251-8730273 CAGCAGCATGAGAAGGAGCAGGG + Intergenic
970352401 4:15216040-15216062 CAGGAGCAAGAGAGGGAGCAGGG - Intergenic
970501222 4:16679294-16679316 AAGGAGGAGGAGAGGGAGGAAGG + Intronic
970906880 4:21226224-21226246 CAGCATAGGGGGAGGGAGGGGGG + Intronic
971201581 4:24514029-24514051 CAGCAGGGGGAGAGGGAGCACGG + Intergenic
971323359 4:25623307-25623329 CAGCCTCTGGAGGAGGAGGAGGG - Intergenic
972217038 4:36909186-36909208 CAGTCTGAGGAGAGGCAGGAGGG - Intergenic
972763670 4:42131858-42131880 TAGGACCAGGAGTGGGAGGATGG - Intronic
973542395 4:51947313-51947335 CAGGACCAAGAGAGTGAGGAGGG - Intergenic
973650611 4:52993983-52994005 CAGCCTCAGGGCTGGGAGGAGGG - Intronic
973824480 4:54691548-54691570 CAGCCTAAGGAGAGGCAGGTTGG + Intronic
973847911 4:54932032-54932054 CATCAGGAGGAGAGGGAGGAGGG - Intergenic
974356514 4:60819982-60820004 CGTCATCAGGAGAGGGAGAGTGG - Intergenic
975607212 4:76167461-76167483 CAGGAGCAAGAGAGAGAGGAGGG - Intronic
975767515 4:77684479-77684501 CAGTAACAGGAGGGGGAGGTAGG - Intergenic
975767825 4:77687602-77687624 AAGAATGAGGAGAGGAAGGAAGG + Intergenic
976133589 4:81911115-81911137 CAGCAGCAAGAGAGAGAGCAAGG - Intronic
976206338 4:82626564-82626586 CAACATCAGAAGCAGGAGGAGGG - Intergenic
976318728 4:83687077-83687099 TAGCCTCAGAAGAGAGAGGAGGG - Intergenic
976726919 4:88223794-88223816 CCTCATCTGGAGAGGGATGAAGG + Intronic
976850519 4:89540204-89540226 GAGCTTCAGGAAAGGGAGGATGG - Intergenic
977061177 4:92258499-92258521 CAGGAACAAGAGAGGGAGTAGGG + Intergenic
977118727 4:93069001-93069023 CAGAAACAAGAGAGAGAGGAGGG + Intronic
978678834 4:111353259-111353281 CACCATCAGGAGAAGGAAAATGG + Intergenic
978690568 4:111504539-111504561 CAGGAGCAAGAGAGAGAGGAGGG - Intergenic
979279309 4:118847323-118847345 CAGCCTCAGGAACAGGAGGAAGG - Intergenic
980279000 4:130693618-130693640 CAGCAAAAGTAGAGGGAGCAAGG + Intergenic
981602614 4:146507638-146507660 AAGCATCTGGACAGGGATGATGG - Intronic
982088138 4:151857190-151857212 TAGCATGAGGGGAGGGAGGAGGG - Intergenic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
984256927 4:177400569-177400591 CAGGAGCAAGAGAGAGAGGAGGG + Intergenic
984257052 4:177401643-177401665 TAGAAACAGGAGAGGGAGGAGGG - Intergenic
984551211 4:181161296-181161318 CAGCATTAGGAAAGCGAGAACGG - Intergenic
984712231 4:182895506-182895528 CAGGTTCGAGAGAGGGAGGAAGG - Intronic
984720306 4:182966043-182966065 TAGCATCTGTAGAGGGAGAATGG - Intergenic
984756945 4:183333250-183333272 AAGCGTGAGGTGAGGGAGGAGGG + Intergenic
985355789 4:189117191-189117213 CAGCATCAGCTGAAGTAGGAGGG - Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985767581 5:1787922-1787944 GAGCAGGAGGGGAGGGAGGAGGG - Intergenic
986184457 5:5422837-5422859 CGGCATCAGCAGAGACAGGACGG + Exonic
986420714 5:7578759-7578781 GAGCATCAGGAATGGGAGTAGGG - Intronic
987187986 5:15444665-15444687 CAGGAGCAAGAGAGAGAGGAGGG - Intergenic
987916358 5:24220004-24220026 TAGACTCAGAAGAGGGAGGATGG - Intergenic
989096060 5:37782259-37782281 CAGTATGAGGAGAGTCAGGAGGG + Intergenic
989108202 5:37883126-37883148 TAGGATGAAGAGAGGGAGGAAGG + Intergenic
989161740 5:38397849-38397871 CAGAAGCAGGTGAGAGAGGAGGG + Intronic
989265153 5:39464762-39464784 CAACATGAGGAAAGGCAGGAAGG - Intergenic
989613547 5:43317506-43317528 CAGTATGAGGAGAGCCAGGAGGG + Intergenic
990184853 5:53201734-53201756 AAGCCTCAGGAGAGGGAGATGGG - Intergenic
991562056 5:67964301-67964323 CAGCCCCAGGTGAGGGATGAGGG - Intergenic
992483274 5:77171920-77171942 CAGGATGAGGGGAGGAAGGATGG + Intergenic
992533112 5:77671402-77671424 CAGAATCTGGAGGGGGTGGAGGG + Intergenic
992680204 5:79145446-79145468 TAGCATGGGGAGAGGGAGGAGGG - Intronic
992975324 5:82111100-82111122 CAGAAATAGGAAAGGGAGGAAGG - Intronic
993177359 5:84503708-84503730 CAGGATTTGGAGAGGGAGGCTGG + Intergenic
993305598 5:86271576-86271598 CAGGATGAGGAATGGGAGGAAGG + Intergenic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994292272 5:98042004-98042026 AAGTATCAGGAGATGGAAGATGG + Intergenic
994497794 5:100535577-100535599 CAGCAACAGCAGGAGGAGGACGG - Exonic
994774532 5:104026069-104026091 GAGAATCTGGATAGGGAGGACGG - Intergenic
995288680 5:110423155-110423177 CAGAATTAGAAGTGGGAGGATGG - Intronic
995848809 5:116522989-116523011 ATTCATCAGGAGAGCGAGGAGGG + Intronic
996004585 5:118405220-118405242 CCCCATCAGGTGAGGAAGGATGG + Intergenic
996217469 5:120887122-120887144 CAGCACCAGCAGAGGGTAGAAGG + Intergenic
996615891 5:125441013-125441035 CAGCATCCGGGGTGGGGGGAGGG + Intergenic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
999310663 5:150549661-150549683 CAGAATCTGGAAAGGGAGAAAGG - Exonic
999366125 5:151024613-151024635 CAGCAGCTGGGGAGGGAGGAAGG + Intronic
999409176 5:151335431-151335453 CAGCACCAGGAAGGGCAGGAAGG + Exonic
999423734 5:151467801-151467823 CAGCACCAGGAAGGGCAGGAAGG - Exonic
999448420 5:151659850-151659872 CTGCAGCAGGAGTGGGAGGGAGG + Intergenic
999473254 5:151874925-151874947 GAGCATGAGGAGGGGAAGGAAGG + Intronic
999546196 5:152631233-152631255 CATCTTCATGACAGGGAGGATGG - Intergenic
999673379 5:153976454-153976476 AAGAGTGAGGAGAGGGAGGATGG - Intergenic
999700337 5:154221814-154221836 CAGCATAAAGAGTGGCAGGAAGG - Intronic
1001252229 5:170155180-170155202 AAGCATGAGGAGAAGGATGAGGG + Intergenic
1001971249 5:175956614-175956636 CAGCAGCGGGTGAAGGAGGAGGG - Intronic
1002206198 5:177564180-177564202 GAGCAAGAGGAGAGGGAGGAAGG - Intergenic
1002246193 5:177887163-177887185 CAGCAGCGGGTGAAGGAGGAGGG + Intergenic
1003405584 6:5824593-5824615 CAGCATCTGGAGAGGATGGCTGG - Intergenic
1003414930 6:5898959-5898981 CAGCAGCAGAAGGTGGAGGAAGG - Intergenic
1003529272 6:6924598-6924620 CAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003756646 6:9128462-9128484 CAGGATCAAGAGAGAGAGGAGGG - Intergenic
1003778313 6:9394604-9394626 GAGAAACAGGAGAGGGAGCATGG + Intergenic
1003935196 6:10968742-10968764 CAGCATCAGGTGAGGGTGTGGGG + Intronic
1005452940 6:25991921-25991943 CCACATCTGGAGAGGGAGGTGGG - Intergenic
1005654429 6:27919534-27919556 CAGTATCAGGAGGAGAAGGAGGG + Intergenic
1005734278 6:28731174-28731196 AAGGAGCAGGAGAGGGAGCAAGG + Intergenic
1006449156 6:34096029-34096051 CAGCAGCAGGAGGGGAGGGAGGG + Intronic
1006717998 6:36132272-36132294 AAGCATAAGGGGAGGGTGGAAGG - Intronic
1006834292 6:36987352-36987374 CATTATCAGGAGTGGGAAGAGGG - Intergenic
1006852098 6:37106042-37106064 CAGCATGGGTAGAGGCAGGAAGG + Intergenic
1007102535 6:39259623-39259645 CAGGATTGGGAGAGGGAGGTGGG - Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007285834 6:40746748-40746770 CACCAACAGGAGATGGGGGAAGG + Intergenic
1007369259 6:41415462-41415484 CAGCATCTTGTGGGGGAGGAGGG + Intergenic
1007528404 6:42517885-42517907 CAGCATGAAGAATGGGAGGAAGG - Intergenic
1007687141 6:43673660-43673682 CCCCTTCAGGAGAGGTAGGAAGG - Intronic
1008154406 6:47996169-47996191 CAGAATCAGGAGAGAGTGGCTGG + Intronic
1009267876 6:61579034-61579056 CAGCAGAAAGAGAGGGAGGTGGG + Intergenic
1009535431 6:64877000-64877022 TAACATCAGAAGAGGGAAGATGG + Intronic
1010813685 6:80329615-80329637 CAGCACCAGCACAGGGAGGAGGG - Intronic
1010823769 6:80448141-80448163 CAGCATCAAGCCAGGAAGGAAGG + Intergenic
1011716029 6:90105998-90106020 GAGCTTCAGAAGAGGGAAGAAGG + Intronic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013564647 6:111345749-111345771 CAGCAGCAGGAAAGGGACAAGGG - Intronic
1013699250 6:112743671-112743693 AAGCATAAGGAGAGGTAGTAGGG - Intergenic
1014701933 6:124699615-124699637 CAGCAGCAAGAGAGTGGGGAAGG - Intronic
1015320392 6:131866421-131866443 CAGCAACAGCAGAGGAAGGAAGG + Intronic
1016292140 6:142537878-142537900 AAGCCTCAGGAGAGGGCGGTGGG - Intergenic
1016733547 6:147451805-147451827 TAGCATGAGGAGGGGGAGTAAGG + Intergenic
1016772141 6:147863443-147863465 CATCATAATGAGAGGCAGGAAGG - Intergenic
1017189847 6:151641342-151641364 CAGGAGCAAGAGAGAGAGGAAGG - Intergenic
1017307171 6:152932204-152932226 CACCATCCAGAAAGGGAGGAGGG - Intergenic
1017664344 6:156705023-156705045 TAGCAGCAGTAGAGGAAGGAAGG - Intergenic
1018122738 6:160652765-160652787 CAACATTTTGAGAGGGAGGAAGG + Intronic
1018363348 6:163095115-163095137 GGGCATCAGGTGAGGGAGGGAGG - Intronic
1018625512 6:165774670-165774692 CTGCTTCTGGAGAGGGAGGAAGG + Intronic
1018757178 6:166860354-166860376 CAGCCCCAGGAGAGGGCAGATGG - Intronic
1019328421 7:451018-451040 CAGACTCAGCAGAGGCAGGAAGG - Intergenic
1019660734 7:2222690-2222712 CAGCTTCAGGAGCGGGAGGCCGG - Exonic
1019887018 7:3913967-3913989 CACCATCAGGGAAGGGAGTATGG - Intronic
1019959823 7:4449798-4449820 CAGCAGCAGGAGCAGGGGGAAGG - Intergenic
1020115322 7:5473000-5473022 CTGCAGCAGGGGAGAGAGGATGG - Intronic
1020138596 7:5599861-5599883 CACCCACAGGAGAGGGAGGCTGG - Intronic
1020150913 7:5680997-5681019 CAGCAGCATGAGAGGGAGTGAGG - Intronic
1020211500 7:6161366-6161388 CTGCATCAGGAGATGGAGTGGGG + Exonic
1020224538 7:6269752-6269774 CAAGATAAGGAGAGAGAGGATGG - Intronic
1020246572 7:6434024-6434046 CAGCCTCCGTAGAGGGAAGAGGG - Intronic
1021117040 7:16755242-16755264 CACCAACAGGAGAAGGAGGTTGG + Intronic
1021446293 7:20737044-20737066 CAGCTTCAGGAGGTGGAGGCAGG + Intronic
1021705914 7:23367579-23367601 CAACGACAGGGGAGGGAGGAAGG + Intronic
1022100576 7:27166776-27166798 TAGCAGCTGGAAAGGGAGGAAGG - Intronic
1022122235 7:27320315-27320337 CAGCATCAGGAAAGTGTGAAGGG + Intergenic
1022171705 7:27837792-27837814 CAGCAGCAGCAGATGCAGGAAGG + Intronic
1022222193 7:28324359-28324381 CAGCTTCAGGAGGGGGAGTGGGG - Intronic
1022413999 7:30162681-30162703 CACTCTCAGGGGAGGGAGGAGGG - Exonic
1022470456 7:30678951-30678973 CACCATCTGGAGAGGGAGCCTGG - Intronic
1022518749 7:30992334-30992356 GACCATAAGGAGAGGGAGAATGG - Intronic
1022525651 7:31035329-31035351 CAGCAGCAGGGGAAGAAGGAGGG + Intergenic
1022753022 7:33252109-33252131 CAGGAGCAAGAGAGGGAGGGGGG + Intronic
1023048244 7:36229908-36229930 GGACATCAGGAGCGGGAGGATGG - Intronic
1023980585 7:45067774-45067796 CAGCCTCAGGAGGGAGAAGAAGG - Intronic
1023981157 7:45070968-45070990 CAGCAGCAAGAAAGGGAAGAAGG - Intronic
1024176333 7:46844628-46844650 CAACATCTGCAGAGGGAGCATGG - Intergenic
1024578118 7:50781405-50781427 CAGCATCGGGGGTGGGAGCAGGG - Intronic
1025194925 7:56925278-56925300 CAGGACCAGAAGAGGGTGGAGGG - Intergenic
1025677027 7:63651665-63651687 CAGGACCAGAAGAGGGTGGAGGG + Intergenic
1025841036 7:65149607-65149629 CAGCATCAAGGGAGTGAGGATGG + Intergenic
1025882009 7:65546341-65546363 CAGCATCAAGGGAGTGAGGATGG - Intergenic
1025891432 7:65656291-65656313 CAGCATCAAGGGAGTGAGGATGG + Intergenic
1025939958 7:66068678-66068700 CAGGAGCAAGAGAGAGAGGAGGG + Intergenic
1026470539 7:70691515-70691537 CAGCATCAGAAGTAGGAAGAAGG - Intronic
1026487613 7:70834990-70835012 CAGGAGCAGGAGAGTGAGGGGGG + Intergenic
1026627773 7:72011482-72011504 CAGGTTCAGGAGAGGGAACAGGG - Intronic
1026876452 7:73881737-73881759 CAGAATCAGGGGAGGGGGGTGGG + Intergenic
1026972943 7:74479056-74479078 CAGCAGCAGGGGATGGAGGACGG - Intronic
1028826777 7:95282596-95282618 CAGCCTCTGGGGAGGGTGGAGGG - Intronic
1028888132 7:95957441-95957463 CAGCAGCAGGAGGAGGAGGAGGG - Intronic
1029157934 7:98530542-98530564 CAGGAGCAAGAGAGAGAGGAGGG - Intergenic
1029479085 7:100802209-100802231 CAGCCACTGGAGAGGGAGGCTGG - Intergenic
1029551540 7:101239444-101239466 TGGCTTCAGGAAAGGGAGGAAGG + Intronic
1029599577 7:101555912-101555934 CAGCATTGGGAGAGGAAGGAGGG - Intronic
1029673203 7:102048214-102048236 CAGGACCAGGAGAGGGTGGAGGG - Intronic
1029871381 7:103696653-103696675 CAGAATTAGGAGTGAGAGGATGG - Intronic
1030161324 7:106511257-106511279 CAGCATGAAGAGAGGAAGCATGG + Intergenic
1031124366 7:117756573-117756595 CATCATCTGGAGAGGGATCATGG + Exonic
1031619815 7:123922714-123922736 GAGCAACAGCAGAGGCAGGAAGG - Intergenic
1031698292 7:124888892-124888914 GAGCCTCAGGAGAGGGAGAGGGG - Intronic
1031824257 7:126543354-126543376 CAGAATCACTAGAGGAAGGAGGG - Intronic
1031868051 7:127061610-127061632 AAGCATCAGCAGGGGGAGGAAGG - Intronic
1032865182 7:135917698-135917720 CATCCTCAGGAGAGGGAAGCAGG + Intergenic
1033069052 7:138185294-138185316 TAGCAACAGGTGAGGAAGGATGG - Intergenic
1033480804 7:141738402-141738424 GATCGTCAGGTGAGGGAGGAAGG + Intronic
1033555619 7:142486457-142486479 AAACATTAGGAGAAGGAGGAGGG - Intergenic
1033560465 7:142525985-142526007 AACCATTAGGAGAAGGAGGAGGG - Intergenic
1034255925 7:149724671-149724693 CAAGATCAGGATGGGGAGGAGGG - Exonic
1034835495 7:154348085-154348107 CAGCATCAGGAGGTGGGGGTGGG - Intronic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1034936289 7:155202922-155202944 GAGGAGCAGGAGAGAGAGGAGGG + Intergenic
1035194164 7:157201470-157201492 CAGCCACAGGGGAGGGAGGGCGG + Intronic
1035453332 7:158993107-158993129 CACCATCAGGAAAGGAAGGCAGG - Intergenic
1035686400 8:1526724-1526746 CCACATCAAGAGAGGAAGGAGGG + Intronic
1036022627 8:4862910-4862932 CAGCACCAAGAGAGGCTGGAGGG + Intronic
1036166364 8:6437830-6437852 AGGCATCAGGGGAGAGAGGAGGG - Intronic
1036685252 8:10905135-10905157 CAGCTTCAGGAGAGGATGCAGGG - Intronic
1037352478 8:17976081-17976103 GTGCAACAGGAAAGGGAGGAAGG - Intronic
1037675886 8:21050471-21050493 CAACATCAGGAAAGTGAGTAGGG + Intergenic
1037752748 8:21693293-21693315 CAGCATCAGGACAGACAGCACGG + Exonic
1037818779 8:22125611-22125633 AGGCAGCTGGAGAGGGAGGAGGG - Exonic
1037852799 8:22346406-22346428 CAGCATCAGAGGAGGAAGGATGG - Intronic
1038269862 8:26066342-26066364 AGGCATCAGGAGAGAGAGGAAGG - Intergenic
1038392578 8:27217627-27217649 CAGCATCAGGAGAAAGACGATGG + Intergenic
1039455682 8:37704526-37704548 CAGCCACAGGAGCTGGAGGAGGG + Intergenic
1039637690 8:39183664-39183686 CAACATCCAGAGAGGTAGGAAGG - Intronic
1039921451 8:41896771-41896793 CCGCCGCAGGAGAGGGAGGGAGG - Intergenic
1040083639 8:43315019-43315041 AAGCAGCAAGAGAGGGAGTAAGG - Intergenic
1041041739 8:53853480-53853502 CAGCAGCAGGTGAGGGTAGAAGG + Intronic
1041099160 8:54379280-54379302 CAGCACCAGGAGAGTGAGTTGGG + Intergenic
1041359043 8:57030893-57030915 CAGCACCAGTAGTGGGAGGCAGG - Intergenic
1041383935 8:57279422-57279444 CAGCTTCAGGAGAGTGAGAAAGG + Intergenic
1041392361 8:57358445-57358467 CAGGAGGAGGAGAGAGAGGAGGG + Intergenic
1042773269 8:72401951-72401973 CAGAATTAGGAAAGGAAGGAGGG + Intergenic
1042874376 8:73427276-73427298 CGGCAGCAGCAGTGGGAGGAGGG + Intronic
1042939735 8:74095671-74095693 CAGCAGCAGAAGAGGTAGGAGGG - Intergenic
1043485869 8:80698744-80698766 CAGCATCAGCAGAGGCAGCCCGG + Intronic
1043930569 8:86086114-86086136 GAGCAGAAAGAGAGGGAGGAGGG + Intronic
1044570436 8:93711928-93711950 AAGCAACAGGAGATGGAGTAAGG + Intronic
1044666837 8:94640844-94640866 CCGCTTCGGGAGGGGGAGGAAGG - Intergenic
1044727582 8:95205760-95205782 CTGTATAAGGATAGGGAGGATGG + Intergenic
1044801985 8:95966655-95966677 CAGCATCCGAGGAAGGAGGAAGG - Intergenic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1045970403 8:108073394-108073416 CAGCAACAGGGGAGGGACTAAGG + Intronic
1046616387 8:116482157-116482179 CAGCAGCAGGAGAGGGCAGGAGG - Intergenic
1047174418 8:122527007-122527029 CAGCAACAGGAGAGAGACCAAGG + Intergenic
1047210350 8:122835433-122835455 AAGCCTCAGGAGAGGGCGGTGGG + Intronic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048282313 8:133114417-133114439 CAGTACTAGGAGAGGGAGGCAGG - Intronic
1048528970 8:135230060-135230082 CAGTGTCAGGGAAGGGAGGAAGG + Intergenic
1048550904 8:135432917-135432939 CAGCCTTGGGAGAGGGAGGGAGG + Intergenic
1049300578 8:141867377-141867399 CATCATCAACAGAGGCAGGACGG - Intergenic
1049789800 8:144467322-144467344 CACCATCTGGAGAGGGGGGCCGG - Exonic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1050128031 9:2379831-2379853 CAGAAGCAAGAGAGGGAGGGAGG - Intergenic
1051262210 9:15275637-15275659 CTTCATCAGGAGATAGAGGAAGG + Intronic
1051274651 9:15387166-15387188 CAGCAGGAAGAGAGAGAGGAGGG - Intergenic
1051369811 9:16348681-16348703 CCGCATGAGGAGAGGCATGAGGG + Intergenic
1051707465 9:19895761-19895783 CCGCATGAGGAGATGGAGGGTGG - Intergenic
1051862228 9:21639179-21639201 CAGCTTCAAGAAAGGAAGGAAGG + Intergenic
1052494534 9:29211513-29211535 GAGCATCAGAAGAGGAAGGAGGG - Intergenic
1052857114 9:33414372-33414394 ACGCATCATGAGAAGGAGGAAGG + Intergenic
1053000255 9:34574013-34574035 AAGCTCCAGGACAGGGAGGAGGG + Intronic
1053140907 9:35682174-35682196 AAGCAGCAGGTGAGGGAGAAGGG + Intronic
1053151110 9:35743747-35743769 AAGCTTCAGAAGAGGGAAGAAGG + Intronic
1053320857 9:37097810-37097832 CAGAATCAGCAGAGGGTGGAGGG + Intergenic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1056254411 9:84783932-84783954 CAGCATGAGGAGATGGAGGTTGG + Intronic
1056263780 9:84875766-84875788 AGACATCAGGAGAGGAAGGAAGG - Intronic
1056856332 9:90132704-90132726 CAGAATCAGCAGCGGAAGGAAGG - Intergenic
1057241044 9:93409556-93409578 CAGCAGGAGGAAAGTGAGGATGG - Intergenic
1057242414 9:93423211-93423233 CAGCAGCAGGATAGGGAAGCTGG + Intergenic
1057353227 9:94317227-94317249 CTGCATCAGGAGAGGGACTGAGG - Intergenic
1057497418 9:95571969-95571991 GAGGAGGAGGAGAGGGAGGAGGG + Intergenic
1057641959 9:96833062-96833084 CAGCAGCAGAAGAGAGAAGACGG - Intronic
1057654523 9:96940364-96940386 CTGCATCAGGAGAGGGACTGAGG + Intronic
1057897977 9:98924805-98924827 GAGCATCAGGAGAGGGTGCCAGG + Intergenic
1058569576 9:106326236-106326258 GAGAATCAAGAGAGGGAGGGAGG + Intergenic
1059935365 9:119304875-119304897 CAGCCTGAGGAGTGGGAGAAAGG - Intronic
1059960334 9:119558440-119558462 CAGCATCTGGGGAAGCAGGAGGG + Intergenic
1060468688 9:123930003-123930025 CAGCCTGAGGGAAGGGAGGAAGG - Exonic
1060750079 9:126163160-126163182 CAGCTTCTGGAAAGGGAGGAGGG - Intergenic
1060817774 9:126644388-126644410 CAGGCTCAGAAGAGGGAGGGGGG + Intronic
1061373910 9:130213016-130213038 CATCATCAGAAGGTGGAGGAGGG - Intronic
1061483055 9:130906596-130906618 CAGCAGCAGGAGAGTCAGGGAGG - Intronic
1061865664 9:133490768-133490790 GAGGAGGAGGAGAGGGAGGAGGG + Intergenic
1062144991 9:134984186-134984208 TAGAAGCAGGAGAGGCAGGAAGG + Intergenic
1062307211 9:135914755-135914777 CACGATCATGAGAGGGAGGTAGG + Intergenic
1062736005 9:138137733-138137755 CTTCATCAGGTGAGGGTGGAGGG + Intergenic
1203780105 EBV:96266-96288 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780152 EBV:96395-96417 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780161 EBV:96419-96441 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780170 EBV:96443-96465 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780199 EBV:96521-96543 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780208 EBV:96545-96567 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1203780217 EBV:96569-96591 CAGGAGCAGGAGGGGCAGGAGGG + Intergenic
1185621959 X:1455469-1455491 CAGGAGCGGGAGAGGCAGGAAGG - Intergenic
1185888210 X:3801843-3801865 CAGGAGCTGGAGAGGCAGGAAGG + Intergenic
1186069960 X:5808802-5808824 AAGCAGCAGGAGAGGGAGGGAGG - Intergenic
1186250419 X:7660162-7660184 AAGCAGGGGGAGAGGGAGGAAGG + Intergenic
1186788714 X:12976119-12976141 CAGCAGTAGGAGAGCGAGAAGGG + Exonic
1186855707 X:13624164-13624186 CAGCAGCAGGAGAGTGAATATGG - Intronic
1187124146 X:16437720-16437742 CAGCATATGGATAGGGAGGTGGG + Intergenic
1187189843 X:17023723-17023745 CAGCATTTGGAGAGGAATGAGGG + Intronic
1187246490 X:17557379-17557401 GAGCATCTGGAGAGGAAGGAGGG + Intronic
1187402807 X:18976790-18976812 AGGGATCAGGAGAGGGAGGAGGG - Intronic
1189110821 X:38286846-38286868 GAGCAAAAGGAGAGGGAGCAGGG - Exonic
1189110846 X:38286969-38286991 CAAGATGAGGAGAGGGAGAAGGG - Exonic
1189504030 X:41593223-41593245 CAGCCACAGGATAGAGAGGATGG + Intronic
1190539276 X:51460368-51460390 CAGTATCTGGTGAGGTAGGAGGG - Intergenic
1190817145 X:53938801-53938823 CAGGATGAGGAGAGGTATGAAGG - Exonic
1191103890 X:56760343-56760365 CAGCAAAAGGAGGGAGAGGAAGG - Intergenic
1191724069 X:64260308-64260330 CAGGAGCAGGAGAGTGAAGAGGG - Intergenic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1192034208 X:67545764-67545786 CAGCAGCGGGAGAGCGAGGGAGG + Exonic
1192447790 X:71223569-71223591 CAGTAGCAGGAAAGGAAGGATGG - Intronic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1194402238 X:93452775-93452797 CAGGAGCAAGAGAGAGAGGAGGG - Intergenic
1194591124 X:95800936-95800958 GAACATCAGGAGAGCGAAGAAGG - Intergenic
1194674993 X:96783683-96783705 CAGAATCAAGACTGGGAGGAGGG - Intronic
1195650008 X:107274386-107274408 CAGCATTGAGAGTGGGAGGAAGG - Intergenic
1195702049 X:107712929-107712951 GCGGAGCAGGAGAGGGAGGAAGG + Intergenic
1195869709 X:109473197-109473219 CAGCAACAGGAAGTGGAGGAGGG - Intronic
1195977130 X:110539464-110539486 CAGCATTGTGAGTGGGAGGAGGG - Intergenic
1196656247 X:118220498-118220520 AAGCATCAGGAGAGGCAGTCAGG - Intergenic
1196845925 X:119896606-119896628 CTCCAACAGGAGAGGGAAGATGG - Intronic
1196980715 X:121210177-121210199 CAGCTTCTGGAGAGGCTGGAGGG - Intergenic
1197417835 X:126196942-126196964 CAGGAGCAGGAGAGAGTGGAGGG - Intergenic
1197460780 X:126737937-126737959 CAGCTCCAGGAGAGGGAGGGAGG - Intergenic
1197710318 X:129661656-129661678 CACAATGAGGAGAGGGAAGATGG - Intergenic
1198052283 X:132960765-132960787 CAGCATGAGGGGGTGGAGGAAGG - Intronic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1199673531 X:150166018-150166040 CTCCATCAGGAGATGGAGGCAGG - Intergenic
1199783310 X:151082624-151082646 GGGCGTCAGGAGAGGGAGGTGGG + Intergenic
1200054767 X:153454503-153454525 CAGCAGCTGGGGAGGGAGGGAGG + Exonic
1200184929 X:154175985-154176007 CAGCTCCAGGAGCTGGAGGAAGG - Intergenic
1200190582 X:154213123-154213145 CAGCTCCAGGAGCTGGAGGAAGG - Intergenic
1200196333 X:154250925-154250947 CAGCTCCAGGAGCTGGAGGAAGG - Intergenic
1200201988 X:154288043-154288065 CAGCTCCAGGAGCTGGAGGAAGG - Exonic
1201143446 Y:11047410-11047432 GAGCATAAGGAGAGGGAGGGAGG + Intergenic
1201300196 Y:12498566-12498588 CAGCAGCAGGAGCGGCAGGGAGG - Intergenic
1201739734 Y:17311109-17311131 CAGCAGCAGGAGGAGGAGGAGGG - Intergenic
1201906782 Y:19093557-19093579 CAGGAGCTGGAGATGGAGGAGGG - Intergenic