ID: 1049847347

View in Genome Browser
Species Human (GRCh38)
Location 8:144809428-144809450
Sequence CAGGCACATCCACTTGGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049847342_1049847347 -10 Left 1049847342 8:144809415-144809437 CCCTCAGCGTGGGCAGGCACATC 0: 1
1: 0
2: 3
3: 9
4: 107
Right 1049847347 8:144809428-144809450 CAGGCACATCCACTTGGTTGGGG 0: 1
1: 0
2: 2
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049847347 Original CRISPR CAGGCACATCCACTTGGTTG GGG Intronic
900034531 1:396049-396071 CAGGGACATCCACCAGGCTGAGG - Intergenic
900055363 1:625937-625959 CAGGGACATCCACCAGGCTGAGG - Intergenic
902973912 1:20074980-20075002 CAGGCACATCCCTCTGGGTGTGG + Intronic
911408125 1:97467172-97467194 CAGGCAGATCCATTCGGTGGAGG - Intronic
913422860 1:118691894-118691916 CAGGCACATACACTTCACTGAGG + Intergenic
914000118 1:143686683-143686705 CAGTGACATTCACTTGGATGAGG + Intergenic
914851248 1:151315917-151315939 CATGTACATCCACATGGATGAGG - Exonic
915244213 1:154544711-154544733 CTTTCACATCCACTTTGTTGAGG + Intronic
915643707 1:157251553-157251575 GAGGCACAACCACTTGGTAGGGG - Intergenic
915665222 1:157438184-157438206 CAGGCACAGCCACTTGGTAGGGG + Intergenic
916634259 1:166651392-166651414 CATGCACATGCACTTGTGTGTGG + Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
919894372 1:201999837-201999859 CAGGAAAATACACTTGGATGTGG + Intronic
922256885 1:223900256-223900278 CAGGGACATCCACCAGGCTGAGG - Intergenic
924338082 1:243003069-243003091 CAGGGACATCCACCAGGCTGAGG - Intergenic
1064134728 10:12740839-12740861 CACTCACATCCCTTTGGTTGAGG + Intronic
1064453483 10:15465281-15465303 GAGGATCATCCAATTGGTTGAGG + Intergenic
1064916986 10:20469593-20469615 CACGTACATCCACTTTTTTGAGG - Intergenic
1066263812 10:33755462-33755484 CAGGGACATTCACTTGGTCTTGG + Intergenic
1067266240 10:44747976-44747998 CAGGCACCCCCACCTGGGTGCGG - Intergenic
1072725255 10:97808796-97808818 CAGGCTCAACCTCTTGGTTCAGG + Intergenic
1074917255 10:117969351-117969373 CAGGCACATTCCCTGAGTTGCGG - Intergenic
1075789292 10:125071962-125071984 CAGGCACTTCCTCTGGGCTGAGG + Intronic
1076235951 10:128864008-128864030 CAGGCACATCCTCTGGGTATGGG + Intergenic
1078930876 11:15911271-15911293 CAGGCAAAAGCATTTGGTTGTGG - Intergenic
1080108666 11:28540812-28540834 ATGGCACAGCCACTTGATTGAGG + Intergenic
1083860075 11:65415653-65415675 CATGCACTGCCACTTGGCTGGGG - Intergenic
1084709710 11:70836342-70836364 CAGGCACAGCCACGTGCCTGAGG - Intronic
1085792464 11:79507863-79507885 GAGGCACATTCACTTGCGTGAGG + Intergenic
1089127154 11:116184697-116184719 AAGGCAAGTCCACCTGGTTGGGG - Intergenic
1090449136 11:126790784-126790806 CAGCCACATCTGCTTGGGTGGGG + Intronic
1091370880 11:135056777-135056799 CAGGCACAGCCCCTGGGATGTGG + Intergenic
1093415861 12:18919884-18919906 CAGGCCCATCCAGATGGTAGAGG - Intergenic
1094385553 12:29889290-29889312 CATGCACATACACATGATTGAGG - Intergenic
1101014830 12:100489438-100489460 CAGCCACAGCCACTTGTTTATGG - Intronic
1102581440 12:113890765-113890787 CAGGCACATCCATTTGCATTGGG - Intronic
1104669604 12:130671326-130671348 TAGGGACATCCTCTTGGGTGAGG - Intronic
1104854941 12:131897050-131897072 CAGCCACACACACCTGGTTGTGG + Intronic
1106644470 13:31617486-31617508 GAGACACATACACTTGGTAGGGG + Intergenic
1106917103 13:34527589-34527611 CTGGCACATTCACAAGGTTGAGG + Intergenic
1109374557 13:61474312-61474334 CAGACATTTCCACTTGGTAGAGG - Intergenic
1113132567 13:107054427-107054449 CAGGCACTGTCACTTGATTGTGG - Intergenic
1114499522 14:23157890-23157912 CAGGAACATCCACTGGACTGTGG + Intronic
1119688623 14:76653206-76653228 AAGCCACATCCAAATGGTTGGGG + Intergenic
1125105542 15:35967027-35967049 CAGGCACTTCCCCTTTGTTATGG + Intergenic
1126180669 15:45782216-45782238 CATTCACAACCACTTGGTTCAGG + Intergenic
1126459612 15:48901023-48901045 CAAGCACATCCATTTGTTTATGG - Intronic
1127869257 15:63057011-63057033 CAGACGCATCCAGCTGGTTGAGG + Exonic
1128711027 15:69872119-69872141 CAGGAACAGCCACTTGCTTGAGG + Intergenic
1130633260 15:85591276-85591298 AAGTCCCATCCACTTGGTTTAGG + Intronic
1131182357 15:90249451-90249473 CAGCCACACCCACTTGGGCGCGG - Intergenic
1138335455 16:56249448-56249470 CAGGCATATCCACTGGGGAGGGG + Intronic
1139751823 16:69113591-69113613 CAGGCATATCCAATTGGATTAGG - Intronic
1140239875 16:73191216-73191238 CAGGTAGATCCACTGGTTTGTGG + Intergenic
1140436279 16:74949681-74949703 GAGGCATAACCACTTGGTTGGGG - Intronic
1141951445 16:87342581-87342603 CGGGCACATCCACTTGCTGAGGG - Intronic
1144292452 17:13839454-13839476 CAGGGGTATCCATTTGGTTGGGG - Intergenic
1145023928 17:19453450-19453472 CAAGCACATTCCCTTGGCTGAGG - Intergenic
1147053608 17:37816989-37817011 CAGCCACACCCACCTGGCTGAGG + Intergenic
1156220261 18:35044068-35044090 CAGGCACATCTTCATTGTTGAGG - Intronic
1161360168 19:3844126-3844148 TAAGCACATTCACGTGGTTGGGG - Intronic
1161583317 19:5092341-5092363 CAGGCACATCCACTCCCATGGGG + Intronic
1161653995 19:5502210-5502232 CAAGCTCATCCACATGGCTGTGG - Intergenic
1164918962 19:32074282-32074304 CAGGCACATCCTCATGGTGAAGG + Intergenic
1168536535 19:57174924-57174946 CAGTCACAATCACCTGGTTGTGG - Intergenic
925899117 2:8495890-8495912 AAGGCACATTCAGCTGGTTGGGG - Intergenic
926761428 2:16282128-16282150 CAGGCACAGACACCTGGCTGTGG + Intergenic
930040692 2:47120630-47120652 CTGGCACATTCATTTGGTGGGGG + Intronic
931638217 2:64359575-64359597 CAGGCACACGCACTTGCATGTGG - Intergenic
934902869 2:98174689-98174711 CAGGCACATGCACAGGGCTGTGG + Intronic
939444943 2:142297239-142297261 AAGGCACATTCACTTTTTTGTGG + Intergenic
940718498 2:157256256-157256278 CAGGCACCACTAATTGGTTGAGG - Intergenic
944656295 2:201879662-201879684 CAGGCCTTTCTACTTGGTTGGGG + Intronic
947460188 2:230297602-230297624 CAGGCACATCTACCTGGCTTGGG - Intronic
948544795 2:238719815-238719837 CAGACACATCCACATGGGGGTGG + Intergenic
1171395680 20:24831481-24831503 CCAGCAGATCCACTTGGTGGGGG - Intergenic
1172783803 20:37452561-37452583 CAGGCACATGCATGTGTTTGGGG + Intergenic
1176016291 20:62935049-62935071 CAGGCACCTCCAATTGAATGAGG + Intronic
1176144607 20:63559961-63559983 CAGCCACATTCACTTGGTTGGGG + Exonic
1179485265 21:41706009-41706031 CAGACACAACCACAGGGTTGTGG - Intergenic
1182667177 22:31968330-31968352 CAGGCACATCCACGAAGCTGAGG + Intergenic
1183459901 22:37943466-37943488 CAGGTAAATGCCCTTGGTTGTGG + Intronic
1183649084 22:39144197-39144219 CTGGCACACCCACTTGGTGTCGG + Intronic
1184198739 22:42950437-42950459 CAGGCACAGCATTTTGGTTGAGG + Intronic
949657972 3:6243259-6243281 CAAGCACTACCCCTTGGTTGGGG - Intergenic
949782000 3:7700198-7700220 CAGGGACATCCACTGAGTCGCGG - Intronic
952870602 3:37896936-37896958 CAGACACATCCTCTTGGTAGAGG + Intronic
953515335 3:43585601-43585623 CAGGTACATTCTCTTGGATGTGG - Intronic
954297789 3:49683810-49683832 CAGGGACATTGCCTTGGTTGGGG + Exonic
954402460 3:50326141-50326163 CAGGGAAATCCACGTGGATGCGG + Exonic
955489867 3:59471289-59471311 CTGGCAGATCCACTTGGTGGGGG + Intergenic
963294076 3:143526181-143526203 CAGTCACATCTTCTTGTTTGGGG + Intronic
964082901 3:152782254-152782276 CAAGCAAATCCACTGGGTTATGG + Intergenic
966019597 3:175191287-175191309 CAGGCACATTCAAATAGTTGAGG + Intronic
967441856 3:189517645-189517667 CAGCCACATCCACTTGAATTCGG - Intergenic
967659597 3:192090680-192090702 CATGCACATCTACTGGGGTGAGG - Intergenic
971559007 4:28050833-28050855 CAAACACATCCCCTTGTTTGGGG - Intergenic
978377985 4:108095527-108095549 AGGCCACATTCACTTGGTTGGGG - Intronic
979239041 4:118432221-118432243 CAGGGACATCCACCAGGCTGAGG + Intergenic
979296848 4:119042773-119042795 CAGGCAGACCCACTTGGTGACGG + Intronic
979608703 4:122667864-122667886 GAGGCACATCCACATTATTGAGG + Intergenic
981805623 4:148711828-148711850 CAGGTCCATTCAGTTGGTTGTGG + Intergenic
984296538 4:177861614-177861636 CAGCCACAGCCACCGGGTTGCGG + Intronic
986650330 5:9957251-9957273 CAGAGACATCCACTTTTTTGTGG + Intergenic
986770337 5:10966978-10967000 GAGGAAAATCCACTTGGTTTTGG - Intergenic
989571923 5:42953236-42953258 CAGCCCCATCCGCTTGGTTCTGG - Intergenic
995109403 5:108412181-108412203 CTGGCAGATCCATTTGGTGGGGG + Intergenic
996753755 5:126915178-126915200 GAGGGCCATCCACTTGGTGGAGG - Intronic
997637964 5:135428640-135428662 CAGGATCATCCAGTTGGTAGTGG - Intergenic
997722587 5:136091226-136091248 CAGTCTGATCCACTTGGTTTGGG - Intergenic
1001008479 5:168075831-168075853 AAGGCACATCTACATGGTGGCGG + Intronic
1001778456 5:174346977-174346999 CAGCAACATCCACTTGGTGGTGG - Intergenic
1002433490 5:179217839-179217861 CAGGCACACTCACTAGGTAGGGG + Intronic
1002739288 5:181422819-181422841 CAGGGACATCCACCAGGCTGAGG + Intergenic
1005136751 6:22577626-22577648 CAGGCACACCCCCTTCCTTGTGG - Intergenic
1007107344 6:39292878-39292900 CAGGAACACCCACTTGGCTATGG - Intergenic
1007752538 6:44079230-44079252 CAGGCTCATCCACTCTGTGGTGG + Intergenic
1010343889 6:74789197-74789219 GAGGCACATCCACCTGTTTGAGG - Intergenic
1017332415 6:153215232-153215254 CAGGCACATCCTCTTCGTGAGGG - Intergenic
1019244398 6:170698378-170698400 CAGGGACATCCACCAGGCTGAGG + Intergenic
1020103041 7:5406110-5406132 AAGGTACATCCACGTTGTTGTGG - Intronic
1020441816 7:8224991-8225013 CAAGCTCAACCACTTGGTTAAGG + Intronic
1023119174 7:36892267-36892289 CAGGGACAGCAACTTGGCTGGGG - Intronic
1024321716 7:48077745-48077767 CTGGCAGATCCATTTGGTAGGGG - Intergenic
1029852722 7:103481557-103481579 CAGGCCCATCCCTTTGGATGGGG - Intronic
1030418181 7:109271749-109271771 CAGGCCCACCAACTTGGTTCTGG - Intergenic
1032804129 7:135339000-135339022 CAGGCTCTTCCTCTTGGCTGGGG - Intergenic
1033482860 7:141759456-141759478 CAGACAAATACAGTTGGTTGCGG - Intronic
1035503727 8:109794-109816 CAGGGACATCCACCAGGCTGAGG - Intergenic
1038588069 8:28809286-28809308 CAGCCACACCCACTTGTTTATGG - Intronic
1039233467 8:35474893-35474915 CATGCACATCCCCTTAGGTGGGG + Intronic
1042972450 8:74425088-74425110 CAGGCACACACATTTGGTTTGGG + Intronic
1044724427 8:95181405-95181427 TAGACACATCCACTTGGCAGAGG - Intergenic
1047992715 8:130303067-130303089 CAGGCACCTCCAGGTGTTTGTGG - Intronic
1048866218 8:138763693-138763715 CAGACACAGCCACTTTGTTCCGG + Intronic
1049473356 8:142785995-142786017 CAGGGACATCCCCTGGGGTGGGG - Intronic
1049847347 8:144809428-144809450 CAGGCACATCCACTTGGTTGGGG + Intronic
1051399901 9:16669513-16669535 CAGCAACTTCCAATTGGTTGAGG + Intronic
1056733337 9:89184145-89184167 CAGGCACATCTACATGGTAGGGG - Intergenic
1059373022 9:113858613-113858635 CAGGCACCTGCACTTGGTAATGG - Intergenic
1059595903 9:115720523-115720545 AAGGCACATCCTCCTGGTAGGGG - Intergenic
1062590996 9:137274621-137274643 CAGGCACATGCAATGGGTTTGGG + Intergenic
1203604586 Un_KI270748v1:47604-47626 CAGGGACATCCACCAGGCTGAGG + Intergenic
1192085285 X:68090222-68090244 CAGACACACACACTTGGTGGGGG - Intronic
1194346240 X:92770859-92770881 CAGGGAAATCCACATGGATGCGG - Intergenic
1196752836 X:119132962-119132984 GATGCACATACTCTTGGTTGAGG - Intronic
1198415075 X:136411758-136411780 AAGGCTCATCCACATGGTTGTGG + Intronic