ID: 1049850985

View in Genome Browser
Species Human (GRCh38)
Location 8:144830027-144830049
Sequence CTGAACTCCACCACCGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049850980_1049850985 4 Left 1049850980 8:144830000-144830022 CCTCCTGTCCTGCCGTTAGTCTC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1049850985 8:144830027-144830049 CTGAACTCCACCACCGCCACAGG No data
1049850976_1049850985 12 Left 1049850976 8:144829992-144830014 CCCTTGCCCCTCCTGTCCTGCCG 0: 1
1: 0
2: 1
3: 50
4: 406
Right 1049850985 8:144830027-144830049 CTGAACTCCACCACCGCCACAGG No data
1049850982_1049850985 -4 Left 1049850982 8:144830008-144830030 CCTGCCGTTAGTCTCCTCTCTGA 0: 1
1: 0
2: 0
3: 31
4: 146
Right 1049850985 8:144830027-144830049 CTGAACTCCACCACCGCCACAGG No data
1049850977_1049850985 11 Left 1049850977 8:144829993-144830015 CCTTGCCCCTCCTGTCCTGCCGT 0: 1
1: 0
2: 3
3: 29
4: 485
Right 1049850985 8:144830027-144830049 CTGAACTCCACCACCGCCACAGG No data
1049850975_1049850985 13 Left 1049850975 8:144829991-144830013 CCCCTTGCCCCTCCTGTCCTGCC 0: 1
1: 0
2: 10
3: 92
4: 853
Right 1049850985 8:144830027-144830049 CTGAACTCCACCACCGCCACAGG No data
1049850979_1049850985 5 Left 1049850979 8:144829999-144830021 CCCTCCTGTCCTGCCGTTAGTCT 0: 1
1: 0
2: 1
3: 6
4: 144
Right 1049850985 8:144830027-144830049 CTGAACTCCACCACCGCCACAGG No data
1049850981_1049850985 1 Left 1049850981 8:144830003-144830025 CCTGTCCTGCCGTTAGTCTCCTC 0: 1
1: 0
2: 1
3: 5
4: 104
Right 1049850985 8:144830027-144830049 CTGAACTCCACCACCGCCACAGG No data
1049850978_1049850985 6 Left 1049850978 8:144829998-144830020 CCCCTCCTGTCCTGCCGTTAGTC 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1049850985 8:144830027-144830049 CTGAACTCCACCACCGCCACAGG No data
1049850974_1049850985 20 Left 1049850974 8:144829984-144830006 CCGTCATCCCCTTGCCCCTCCTG 0: 1
1: 0
2: 6
3: 99
4: 916
Right 1049850985 8:144830027-144830049 CTGAACTCCACCACCGCCACAGG No data
1049850983_1049850985 -8 Left 1049850983 8:144830012-144830034 CCGTTAGTCTCCTCTCTGAACTC 0: 1
1: 0
2: 2
3: 15
4: 310
Right 1049850985 8:144830027-144830049 CTGAACTCCACCACCGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049850985 Original CRISPR CTGAACTCCACCACCGCCAC AGG Intronic
No off target data available for this crispr