ID: 1049851359

View in Genome Browser
Species Human (GRCh38)
Location 8:144832815-144832837
Sequence CCCAATACAAATGTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049851359 Original CRISPR CCCAATACAAATGTGGAGCT GGG (reversed) Intronic
901391334 1:8948242-8948264 TCCCATACAGCTGTGGAGCTTGG - Intronic
905305323 1:37013860-37013882 CCCAAGACAAAGTTGGAGCAGGG + Intronic
905864358 1:41368635-41368657 CCCAACCCATATGTGGAGGTGGG + Intronic
909102550 1:71367565-71367587 CCTAATATAAATATGGAGTTTGG - Intergenic
909948297 1:81688968-81688990 CCCAGTACCAGCGTGGAGCTGGG - Intronic
914387684 1:147187470-147187492 CCAAATAGAAATGTGGAGAGGGG + Intronic
915177300 1:154026641-154026663 CCTAATAGAAATTTGGGGCTGGG - Intronic
915183244 1:154081684-154081706 CCCAATAAAACGCTGGAGCTGGG + Intronic
918976113 1:191488628-191488650 CAATATACAATTGTGGAGCTGGG + Intergenic
922771170 1:228183975-228183997 CCCAAAACAAATGGGCAGATGGG - Intergenic
1062804647 10:408676-408698 CCCAGTTTAGATGTGGAGCTTGG - Intronic
1064399354 10:15008337-15008359 CACAATCCAACTGTGCAGCTGGG + Intergenic
1069998765 10:72360467-72360489 CCCAATACAAAGGTGGTTTTAGG - Intergenic
1070721386 10:78759635-78759657 CTCAATACAAAGAAGGAGCTTGG - Intergenic
1072773767 10:98168084-98168106 CTCAATACACATCTGGAGGTTGG - Intronic
1077604573 11:3600118-3600140 CACAATTCAACTGTGCAGCTGGG + Intergenic
1084227031 11:67722933-67722955 CACAATCCAACTGTGCAGCTGGG + Intergenic
1084260465 11:67974709-67974731 CACAATCCAACTGTGCAGCTGGG + Intergenic
1084594503 11:70108958-70108980 CCCAATTAAATTGTGTAGCTGGG + Intronic
1084808163 11:71593923-71593945 CACAATCCAACTGTGCAGCTGGG - Intronic
1084812306 11:71620536-71620558 CACAATCCAACTGTGCAGCTGGG - Intergenic
1084845277 11:71893936-71893958 CACAATCCAACTGTGCAGCTGGG - Intronic
1089903014 11:122007952-122007974 GCCAAAACAAATGAGGAGCTTGG - Intergenic
1091112168 11:132979700-132979722 CTCAAGAAAAATGTGAAGCTGGG + Intronic
1092431726 12:8415254-8415276 CACAATCCAACTGTGCAGCTGGG + Intergenic
1092434677 12:8437874-8437896 CACAATCCAACTGTGCAGCTGGG + Intergenic
1095080679 12:37995959-37995981 CCCCATACAGGTGTTGAGCTGGG - Intergenic
1100485156 12:95018380-95018402 CCCAAAAAAAATGTGGAGCAAGG - Intergenic
1104723193 12:131057795-131057817 CCCACAACACAGGTGGAGCTGGG + Intronic
1105255813 13:18743558-18743580 CCCACTTCAGATGTGGTGCTGGG - Intergenic
1105482129 13:20787897-20787919 CCCATTAGTAATGTTGAGCTGGG - Intronic
1107546722 13:41440311-41440333 CACAATCCAACTGTGCAGCTGGG + Intergenic
1111686807 13:91512504-91512526 CCCAGTACAAATCAGGAGCAGGG - Intronic
1111719959 13:91930632-91930654 CCCAATAAATATGTGAAGGTCGG + Intronic
1112160171 13:96858993-96859015 CCCAATACACAAGTGGATATGGG - Intergenic
1112279510 13:98050472-98050494 CCCATTACCAATTTGGTGCTTGG + Intergenic
1112772017 13:102801943-102801965 CCAAAAAGTAATGTGGAGCTTGG + Intronic
1115111211 14:29825034-29825056 CCCAATAAAAATTTGAAGCGTGG - Intronic
1117039592 14:51757489-51757511 CACAATCCAACTGTGCAGCTGGG - Intergenic
1117806770 14:59500951-59500973 CCCACTACAACTGCAGAGCTGGG + Intronic
1121814715 14:96920449-96920471 ACCAATAGGAAGGTGGAGCTGGG + Intronic
1122363598 14:101181815-101181837 CCCACTATAAGTGAGGAGCTGGG - Intergenic
1129657626 15:77534752-77534774 CTCCATTCAAATGTGGAACTAGG + Intergenic
1134263622 16:12674145-12674167 CCCAATTCCAATGAGGAACTTGG + Intronic
1138273557 16:55713674-55713696 CCCAATCAAGATGCGGAGCTTGG - Intergenic
1141916221 16:87099017-87099039 CCCAGCTCAAATATGGAGCTGGG - Intronic
1148021201 17:44555213-44555235 CCCAAGGCAGATGGGGAGCTGGG - Intergenic
1148685652 17:49499460-49499482 CCCAGGACAAGTGTGGAGCCAGG + Intronic
1150051429 17:61968210-61968232 CCCAACAAAAATGTGGGGATTGG + Exonic
1151285217 17:73105954-73105976 CCCAATGGAAATGAGAAGCTAGG + Intergenic
1152239806 17:79155344-79155366 CCCAACTCAACAGTGGAGCTGGG + Intronic
1157222612 18:45838567-45838589 CCCAATACAGATGTGGCCTTGGG - Intronic
1157817208 18:50738307-50738329 TCCAAGAGACATGTGGAGCTGGG + Intergenic
1158356407 18:56625004-56625026 TCTTATACAATTGTGGAGCTAGG - Intronic
1161457060 19:4374816-4374838 CCCCACACCCATGTGGAGCTGGG - Intronic
1162237284 19:9319322-9319344 CCAATTACAAATGAGGAGGTGGG + Intergenic
1165773931 19:38394201-38394223 CCCAATAACAGTGTGGGGCTGGG + Intronic
926577499 2:14598206-14598228 CCCAATACAGGTGTGGAGAATGG + Intergenic
928723709 2:34147998-34148020 CCCACTTCAATTGTGGAGCAAGG - Intergenic
930042983 2:47143124-47143146 ACCATTACAAATGTTGAGGTTGG - Intronic
930200162 2:48545182-48545204 CCGAATAAAAATGTTGACCTAGG - Intronic
930800480 2:55438191-55438213 CCCACTGCAATTGTGGAGCAAGG + Intergenic
933291030 2:80438318-80438340 CCTAATACAATTATGGAGTTAGG + Intronic
934161767 2:89256454-89256476 CCCAATACATCTGTGGAACCAGG - Intergenic
934205515 2:89925908-89925930 CCCAATACATCTGTGGAACCAGG + Intergenic
934590645 2:95547053-95547075 CACAATCCAACTGTGCAGCTGGG - Intergenic
940154438 2:150639176-150639198 ACAAATGCAATTGTGGAGCTTGG + Intergenic
941609722 2:167645869-167645891 CCCAATAAAAATGTGTACTTGGG + Intergenic
946127110 2:217572629-217572651 CCCAATAAAAATGTGTTGTTTGG - Intronic
946787542 2:223263484-223263506 CCCAAGACAAATAAGGAGCCTGG - Intergenic
947694281 2:232170545-232170567 ACCATTACAAATGTGAAACTTGG + Intronic
1169465264 20:5832357-5832379 CCAAATACAAAGGTGTAACTTGG + Intronic
1175300777 20:57941320-57941342 CCCAAAGCAAATGTGGACCAAGG + Intergenic
1175589900 20:60181000-60181022 CCCTATACAACTCTGTAGCTGGG + Intergenic
1175794740 20:61764627-61764649 CCCCATGCATAAGTGGAGCTTGG - Intronic
1178826925 21:36024937-36024959 CCTAATGCACCTGTGGAGCTCGG + Intergenic
1179261947 21:39765301-39765323 CCCAATACAGCTGTAGAGTTAGG + Intronic
1179720275 21:43312538-43312560 CCCAACACCACTCTGGAGCTGGG + Intergenic
951100433 3:18682267-18682289 ACCAATAGAAATTTGGAGCTGGG - Intergenic
952926478 3:38323871-38323893 CTCAATACAAAAATGGGGCTAGG - Intergenic
955760718 3:62278928-62278950 CCCCATACAAATGAGCTGCTGGG - Intronic
956447718 3:69342159-69342181 CCCAATACAAATCTAGATCCAGG - Intronic
957075422 3:75599125-75599147 CACAATCCAACTGTGCAGCTGGG + Intergenic
958890182 3:99774590-99774612 CCCAACACACATGTTGGGCTTGG - Intronic
958969871 3:100600268-100600290 CCCAGTACCAACCTGGAGCTGGG - Intergenic
959981680 3:112524665-112524687 CACAATCCAACTGTGCAGCTGGG + Intergenic
960538048 3:118834697-118834719 CCCAATTCCAATGTGGTCCTTGG + Intergenic
960944571 3:122957355-122957377 CCCAGTCCAACTGTGGGGCTTGG + Intronic
961239260 3:125396266-125396288 CCCAATACTAGTGGGTAGCTTGG + Intergenic
961273020 3:125703841-125703863 CACAATCCAACTGTGCAGCTGGG - Intergenic
961275762 3:125725009-125725031 CACAATCCAACTGTGCAGCTGGG - Intergenic
961278683 3:125747604-125747626 CACAATCCAACTGTGCAGCTGGG - Intergenic
961875719 3:130022030-130022052 CACAATCCAACTGTGCAGCTGGG + Intergenic
964064647 3:152563207-152563229 CCAATTACAACTGTGGAGGTGGG - Intergenic
965934672 3:174092829-174092851 GCCAATTCAAATGTGGACCATGG + Intronic
966676453 3:182595417-182595439 CCAAATACACGTGTGCAGCTGGG - Intergenic
968780208 4:2574692-2574714 CCTTAAATAAATGTGGAGCTGGG + Intronic
969730112 4:8950118-8950140 CACAATCCAACTGTGCAGCTGGG - Intergenic
969786275 4:9459748-9459770 CACAATCCAACTGTGCAGCTGGG - Intergenic
969789716 4:9484232-9484254 CACAATTCAACTGTGCAGCTGGG - Intergenic
969794192 4:9513398-9513420 CACAATTCAACTGTGCAGCTGGG - Intergenic
976597679 4:86909216-86909238 ACCATTACATATGAGGAGCTGGG + Intronic
982781530 4:159496258-159496280 CCCACCACAAATATGGAGCTCGG - Intergenic
983536538 4:168863218-168863240 CCCAGTACAAATCTGGTGCTTGG - Intronic
987156494 5:15094957-15094979 CCCAATACACCTGAGGAGTTGGG - Intergenic
993826192 5:92690103-92690125 CCCAATAAAAATGTCTAGCTAGG + Intergenic
994231605 5:97314886-97314908 CCAATTACAAATGAGGAGGTGGG + Intergenic
999280648 5:150363197-150363219 CCCAACAAAAATGTTGAGCAGGG - Intronic
1001304559 5:170562264-170562286 CCCAGCACAAGTGTGGAGCCAGG + Intronic
1001906496 5:175478208-175478230 CCCAATTAAAGTGTGGAGCTTGG - Intronic
1007131942 6:39483396-39483418 CAGAAATCAAATGTGGAGCTGGG - Intronic
1012502441 6:99904014-99904036 CCCAGTAGAACTTTGGAGCTGGG - Intergenic
1018273639 6:162106987-162107009 TTCAATACACATGAGGAGCTCGG + Intronic
1020310814 7:6867129-6867151 CACAATCCAACTGTGCAGCTGGG + Intergenic
1021744998 7:23731172-23731194 CCAAATACAAATGTTTAGCCGGG - Intronic
1025571203 7:62571405-62571427 ACCAATAGAAATGTTCAGCTTGG + Intergenic
1027564389 7:79772978-79773000 CCAAATGCCAATGTGCAGCTGGG - Intergenic
1029077521 7:97947457-97947479 CACAATTCAACTGTGCAGCTGGG + Intergenic
1029681728 7:102116143-102116165 CCCCATACAGAGGTGGAGCCTGG - Intronic
1032024363 7:128429916-128429938 CTCAACACAAATGTGGGGCATGG + Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1036261783 8:7247092-7247114 CACAATCCAACTGTGCAGCTGGG + Intergenic
1036304808 8:7592460-7592482 CACAATCCAACTGTGCAGCTGGG - Intergenic
1036313823 8:7705637-7705659 CACAATCCAACTGTGCAGCTGGG + Intergenic
1036355659 8:8040452-8040474 CACAATCCAACTGTGCAGCTGGG - Intergenic
1036819512 8:11929042-11929064 CACAATGCAACTGTGCAGCTGGG + Intergenic
1036832683 8:12034091-12034113 CACAATCCAACTGTGCAGCTGGG + Intergenic
1036902855 8:12684614-12684636 CACAATCCAACTGTGCAGCTGGG + Intergenic
1036905275 8:12703526-12703548 CACAATCCAACTGTGCAGCTGGG + Intergenic
1040535171 8:48302801-48302823 TCCAGGACCAATGTGGAGCTGGG - Intergenic
1041740028 8:61148296-61148318 CACAACACAGATGTGGAGGTGGG + Intronic
1045234085 8:100334600-100334622 ACCAATAAAATTCTGGAGCTCGG - Intronic
1045471531 8:102516666-102516688 CCCAATATAAATGTGTACATAGG - Intergenic
1046631401 8:116626137-116626159 CCAAATACAACAGTGGAGGTAGG - Intergenic
1048651946 8:136487685-136487707 CTCATTCTAAATGTGGAGCTTGG + Intergenic
1049851359 8:144832815-144832837 CCCAATACAAATGTGGAGCTGGG - Intronic
1051930126 9:22374987-22375009 CCAAATTCACTTGTGGAGCTAGG + Intergenic
1055612608 9:78038448-78038470 ATGAATACAAATGTGGAGGTCGG - Intergenic
1056444965 9:86656679-86656701 CTCCATACAAAAGTGGAGTTTGG - Intergenic
1059605181 9:115826591-115826613 CCAGAACCAAATGTGGAGCTGGG + Intergenic
1059867765 9:118535737-118535759 CCAAATACAAATATTGAGATAGG - Intergenic
1189566642 X:42248373-42248395 CCCAATACGAAAATGGAGTTGGG - Intergenic
1190105596 X:47558991-47559013 CCGAATAGAAAAGTGGAGTTGGG + Intergenic
1193028698 X:76874764-76874786 CCCAAGAGCAATGTGGAGCCAGG + Intergenic
1196023625 X:111016544-111016566 CGCAAAACAAATTTGGATCTTGG - Intronic
1196988580 X:121302297-121302319 CCCTTTACAAATTTGGACCTTGG + Intergenic
1198628755 X:138610421-138610443 TCCAATTCAAACGTGGAGATTGG - Intergenic
1200880698 Y:8208992-8209014 CCAATTACAAATGTGGAGGTGGG + Intergenic
1201515863 Y:14818336-14818358 CCAATTACAACTGAGGAGCTGGG + Intronic
1201640145 Y:16169475-16169497 CCAATTACAACTGAGGAGCTGGG + Intergenic
1201648779 Y:16263509-16263531 CCAAATACAACTGAGGAGGTGGG + Intergenic
1201654030 Y:16321791-16321813 CCAAATACAACTGAGGAGGTGGG - Intergenic
1201662669 Y:16415850-16415872 CCAATTACAACTGAGGAGCTGGG - Intergenic