ID: 1049852492

View in Genome Browser
Species Human (GRCh38)
Location 8:144840533-144840555
Sequence GTCTGTGATCAAACCATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049852492_1049852494 6 Left 1049852492 8:144840533-144840555 CCTGTCATGGTTTGATCACAGAC 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1049852494 8:144840562-144840584 GAGATGTCTGACCTCAGCAGAGG No data
1049852492_1049852496 17 Left 1049852492 8:144840533-144840555 CCTGTCATGGTTTGATCACAGAC 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1049852496 8:144840573-144840595 CCTCAGCAGAGGTGCCCTCTAGG No data
1049852492_1049852498 30 Left 1049852492 8:144840533-144840555 CCTGTCATGGTTTGATCACAGAC 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1049852498 8:144840586-144840608 GCCCTCTAGGGTTACAGAGTAGG No data
1049852492_1049852497 18 Left 1049852492 8:144840533-144840555 CCTGTCATGGTTTGATCACAGAC 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1049852497 8:144840574-144840596 CTCAGCAGAGGTGCCCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049852492 Original CRISPR GTCTGTGATCAAACCATGAC AGG (reversed) Intronic
900559758 1:3298188-3298210 GTCTCTGATCAATGCCTGACGGG - Intronic
906839546 1:49121944-49121966 GTCTGAGATCAAACTGTGAGGGG - Intronic
908051233 1:60233434-60233456 GTATGTGCTAAAACCATGTCAGG - Intergenic
908390862 1:63682422-63682444 GTGTGTGAGGAACCCATGACAGG - Intergenic
910530053 1:88225590-88225612 GTCTGTGAGCAAATGGTGACTGG - Intergenic
912558606 1:110534233-110534255 GTGTGTGCTAAAGCCATGACAGG + Intergenic
920337980 1:205257709-205257731 GTCTGTGAAGAAACAGTGACAGG + Intronic
924902744 1:248418714-248418736 TGCTGTGATCAACCCATCACGGG - Intergenic
1063597423 10:7449120-7449142 GTCTGTGATAAAACATTCACTGG + Intergenic
1065177366 10:23092020-23092042 ATCTGTGATCAAGCCCTTACTGG - Intergenic
1068131185 10:52897313-52897335 GTCTGGGATCAAGTCCTGACAGG - Intergenic
1069632939 10:69908521-69908543 GGCTGGCATCATACCATGACAGG + Intronic
1078820887 11:14880724-14880746 GTCTGTGATCAACCCATCCTCGG + Exonic
1082167002 11:48961750-48961772 CTCTGTGCTCAACCCATCACTGG + Intergenic
1084977369 11:72809497-72809519 GACTGCGATCACACCAGGACTGG - Intergenic
1086693549 11:89817382-89817404 GTCTGTGAACAACCTATGTCAGG + Intergenic
1086712597 11:90027187-90027209 GTCTGTGAACAACCTATGTCAGG - Intergenic
1088692388 11:112338861-112338883 GCCTGTGTTCAAGCCAAGACTGG + Intergenic
1092506433 12:9106149-9106171 GTTTGTGCTAAAACCATGCCTGG - Intronic
1094303773 12:28995243-28995265 GTCTATGATGAACCCATGAAAGG + Intergenic
1097014999 12:55979608-55979630 GTCTATGACCAAACCCTGCCAGG - Intronic
1098359095 12:69637762-69637784 GAATGTGAGCAAAGCATGACAGG - Intergenic
1103485946 12:121282686-121282708 GTCTGGGATCAAGCCTTGGCAGG - Intronic
1104037946 12:125111168-125111190 GTCTGTGAACACACCCCGACTGG - Intronic
1107120016 13:36786038-36786060 GTCTCTGATCATATCCTGACTGG + Intergenic
1107299827 13:38954123-38954145 TAATGTGATCAAACCAAGACTGG + Intergenic
1108207330 13:48103664-48103686 GCCTGTGATCAAACCCTTTCTGG + Intergenic
1109848564 13:68030751-68030773 GACTGTTCTCAAACCAAGACAGG - Intergenic
1110865094 13:80384859-80384881 GTCTGTGAGCCAAGCATCACAGG - Intergenic
1115121752 14:29945170-29945192 GTAGTTGAACAAACCATGACAGG + Intronic
1119698115 14:76730270-76730292 GTCTGTGAGGCAATCATGACTGG + Intergenic
1121498118 14:94411685-94411707 GTCTGTTATGAAACCATGCAAGG + Intergenic
1125009590 15:34856551-34856573 CTCAGTGATCAAAACATGAAAGG + Exonic
1136508988 16:30724282-30724304 GTCTGTGATGAAGCCAGGACAGG - Exonic
1142337944 16:89502359-89502381 GTCTGTGGTAAAAGCATGACTGG - Intronic
1145300735 17:21634372-21634394 TTCTGTGATCTATCCATGTCTGG + Intergenic
1147617218 17:41836518-41836540 GTTTGTGACAAAAACATGACTGG + Intronic
1149415892 17:56459634-56459656 GTCTGTGATCCAGGCATGTCTGG - Intronic
1152490994 17:80633590-80633612 GGCTGTGATCTATCCATTACTGG + Intronic
1160872574 19:1283897-1283919 GTCTCTTCTCAAACCAGGACTGG - Intergenic
929443482 2:41984672-41984694 GTATGTGGGAAAACCATGACAGG + Intergenic
933308992 2:80637382-80637404 GCCTGAGTTCAAACCTTGACTGG - Intronic
933891103 2:86770902-86770924 GTCTGTGACACAATCATGACAGG - Intronic
937253616 2:120539884-120539906 GTTTGTGATCAGACCATGCGAGG + Intergenic
940394353 2:153170754-153170776 GTCTGTCATCAAAACATTATGGG - Intergenic
940543920 2:155058421-155058443 CTCCATGATCTAACCATGACAGG - Intergenic
940788198 2:158004519-158004541 GTCTGTGAACAAACCCCTACAGG + Intronic
947003321 2:225483408-225483430 GTCTCTGCTCAAACCAGGGCAGG - Intronic
948789831 2:240371522-240371544 GTCTCTGCTCACACCCTGACCGG - Intergenic
1169897203 20:10517199-10517221 GACTGTCATCAAACCCTCACAGG + Intronic
1170857397 20:20069781-20069803 TTCTGTGATAAAAACATAACTGG + Intronic
1176651350 21:9550547-9550569 TTCTGTGATCTATCCATGTCTGG + Intergenic
1177125777 21:17191773-17191795 CTCTGTGCTCAGTCCATGACTGG - Intergenic
1178166711 21:29986013-29986035 ATCTGTGCTCAACCCATGGCTGG - Intergenic
1178669572 21:34578838-34578860 GGCTGTGGTCACACCATGCCTGG + Intronic
1183587012 22:38758697-38758719 GTCTGTCATTTAACCATCACAGG + Intronic
1185071604 22:48659641-48659663 GTCCCTCATCAAACCAGGACAGG - Intronic
1185093320 22:48789352-48789374 GTCTGTGATGGAAACAGGACAGG + Intronic
949330968 3:2921643-2921665 GTCTGTGATAGAAGCATCACTGG - Intronic
950473381 3:13200326-13200348 AACTATGAGCAAACCATGACCGG + Intergenic
951796912 3:26549216-26549238 TTCTGTGGTCATACAATGACTGG - Intergenic
955617994 3:60829279-60829301 CTCTGTGATCAAACCCAGAGGGG - Intronic
962872193 3:139507057-139507079 CTCAGTGCTGAAACCATGACTGG - Intergenic
963334078 3:143952285-143952307 GTCTGTGATTAAAATTTGACTGG - Intergenic
969646606 4:8433567-8433589 GTATGTGATCAAACACTGAATGG + Intronic
976379855 4:84386955-84386977 GTCTGTCTTCAAACCATAAAAGG + Intergenic
982556420 4:156871834-156871856 TTCTGTGTGCAAAACATGACTGG - Intronic
984543876 4:181074844-181074866 CTCTGTGCTCAACCCCTGACAGG - Intergenic
988752709 5:34206927-34206949 CTCTGAGAGCAAACCCTGACAGG + Intergenic
991607428 5:68417263-68417285 GTCTTTGAACAAGGCATGACTGG + Intergenic
991653520 5:68880704-68880726 CTCTGTGACTAGACCATGACAGG + Intergenic
999277962 5:150344572-150344594 CTCTGTTATCAAACCATCATCGG - Intergenic
1000253825 5:159519523-159519545 GTGAGTGAGCAAACCATGAGAGG - Intergenic
1003644058 6:7900037-7900059 GTCTGTGTTCAAATTAGGACTGG + Intronic
1004287999 6:14340550-14340572 CTCTCTGATAAAAGCATGACTGG + Intergenic
1010517695 6:76792907-76792929 GTCTGTGATCTCACTATTACGGG + Intergenic
1012389448 6:98720619-98720641 GTCTGTCATCAAACCAGGGGAGG - Intergenic
1012961198 6:105623692-105623714 GGCTGTGATCAGATTATGACAGG - Intergenic
1016830718 6:148430737-148430759 GTCTGGGATGGGACCATGACTGG + Intronic
1026664884 7:72333732-72333754 GTCTGGGCTCAAACCAGTACAGG + Intronic
1028698973 7:93753837-93753859 ATTTATGATCAAATCATGACAGG + Intronic
1028714676 7:93951218-93951240 GTCTGTGTTGGAAACATGACTGG + Intergenic
1031606609 7:123775743-123775765 GTCTGTCATCTAAAGATGACAGG - Intergenic
1033018622 7:137698796-137698818 ATCAGTGATAAAACCAAGACTGG + Intronic
1033753403 7:144377661-144377683 GTCTGTGTTCACACCAAGACTGG + Intronic
1034536244 7:151727676-151727698 TTCTGTGATCAAAACAGGGCTGG + Intronic
1043493489 8:80774550-80774572 GTCTCTGCTCACACCATGAAGGG + Intronic
1045170583 8:99663230-99663252 GTCTCTGTTTAATCCATGACTGG - Intronic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1049852492 8:144840533-144840555 GTCTGTGATCAAACCATGACAGG - Intronic
1051205862 9:14688460-14688482 GCCTGTGATCATACCATGTTGGG + Intronic
1051435023 9:17021510-17021532 GTCTGAGATTAAAACCTGACAGG + Intergenic
1054356714 9:64069912-64069934 GTCTGTGTTCAAATACTGACTGG + Intergenic
1062564773 9:137159290-137159312 GTCTGTGATGCTACCAGGACTGG - Intronic
1203629083 Un_KI270750v1:54099-54121 TTCTGTGATCTATCCATGTCTGG + Intergenic
1188170854 X:26923945-26923967 GTTTATGATCAAACTGTGACAGG - Intergenic