ID: 1049853688

View in Genome Browser
Species Human (GRCh38)
Location 8:144848680-144848702
Sequence CTAAGTCTGCTCCACGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049853684_1049853688 24 Left 1049853684 8:144848633-144848655 CCTTTGTGGGAAGAGTTTGCTCA No data
Right 1049853688 8:144848680-144848702 CTAAGTCTGCTCCACGCTGTAGG No data
1049853683_1049853688 25 Left 1049853683 8:144848632-144848654 CCCTTTGTGGGAAGAGTTTGCTC No data
Right 1049853688 8:144848680-144848702 CTAAGTCTGCTCCACGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049853688 Original CRISPR CTAAGTCTGCTCCACGCTGT AGG Intronic