ID: 1049855072

View in Genome Browser
Species Human (GRCh38)
Location 8:144856629-144856651
Sequence CTTCACCTGCAGACAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049855072_1049855078 -3 Left 1049855072 8:144856629-144856651 CCACCCACTGTCTGCAGGTGAAG No data
Right 1049855078 8:144856649-144856671 AAGAGGGTGCTGTTCTGGTTAGG No data
1049855072_1049855085 28 Left 1049855072 8:144856629-144856651 CCACCCACTGTCTGCAGGTGAAG No data
Right 1049855085 8:144856680-144856702 CACTGACGGTCCCTGGCACAAGG No data
1049855072_1049855077 -8 Left 1049855072 8:144856629-144856651 CCACCCACTGTCTGCAGGTGAAG No data
Right 1049855077 8:144856644-144856666 AGGTGAAGAGGGTGCTGTTCTGG No data
1049855072_1049855083 14 Left 1049855072 8:144856629-144856651 CCACCCACTGTCTGCAGGTGAAG No data
Right 1049855083 8:144856666-144856688 GTTAGGAGGTGGGGCACTGACGG No data
1049855072_1049855079 0 Left 1049855072 8:144856629-144856651 CCACCCACTGTCTGCAGGTGAAG No data
Right 1049855079 8:144856652-144856674 AGGGTGCTGTTCTGGTTAGGAGG No data
1049855072_1049855080 3 Left 1049855072 8:144856629-144856651 CCACCCACTGTCTGCAGGTGAAG No data
Right 1049855080 8:144856655-144856677 GTGCTGTTCTGGTTAGGAGGTGG No data
1049855072_1049855084 21 Left 1049855072 8:144856629-144856651 CCACCCACTGTCTGCAGGTGAAG No data
Right 1049855084 8:144856673-144856695 GGTGGGGCACTGACGGTCCCTGG No data
1049855072_1049855082 5 Left 1049855072 8:144856629-144856651 CCACCCACTGTCTGCAGGTGAAG No data
Right 1049855082 8:144856657-144856679 GCTGTTCTGGTTAGGAGGTGGGG No data
1049855072_1049855081 4 Left 1049855072 8:144856629-144856651 CCACCCACTGTCTGCAGGTGAAG No data
Right 1049855081 8:144856656-144856678 TGCTGTTCTGGTTAGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049855072 Original CRISPR CTTCACCTGCAGACAGTGGG TGG (reversed) Intergenic
No off target data available for this crispr