ID: 1049855738

View in Genome Browser
Species Human (GRCh38)
Location 8:144860702-144860724
Sequence TCTCCGTGTAACCAACTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049855738_1049855744 0 Left 1049855738 8:144860702-144860724 CCCTTGAGTTGGTTACACGGAGA No data
Right 1049855744 8:144860725-144860747 GCAGTGCTGGCAGAGAGGGGAGG No data
1049855738_1049855746 2 Left 1049855738 8:144860702-144860724 CCCTTGAGTTGGTTACACGGAGA No data
Right 1049855746 8:144860727-144860749 AGTGCTGGCAGAGAGGGGAGGGG No data
1049855738_1049855741 -5 Left 1049855738 8:144860702-144860724 CCCTTGAGTTGGTTACACGGAGA No data
Right 1049855741 8:144860720-144860742 GGAGAGCAGTGCTGGCAGAGAGG No data
1049855738_1049855742 -4 Left 1049855738 8:144860702-144860724 CCCTTGAGTTGGTTACACGGAGA No data
Right 1049855742 8:144860721-144860743 GAGAGCAGTGCTGGCAGAGAGGG No data
1049855738_1049855747 13 Left 1049855738 8:144860702-144860724 CCCTTGAGTTGGTTACACGGAGA No data
Right 1049855747 8:144860738-144860760 AGAGGGGAGGGGTTGATAAGAGG No data
1049855738_1049855745 1 Left 1049855738 8:144860702-144860724 CCCTTGAGTTGGTTACACGGAGA No data
Right 1049855745 8:144860726-144860748 CAGTGCTGGCAGAGAGGGGAGGG No data
1049855738_1049855743 -3 Left 1049855738 8:144860702-144860724 CCCTTGAGTTGGTTACACGGAGA No data
Right 1049855743 8:144860722-144860744 AGAGCAGTGCTGGCAGAGAGGGG No data
1049855738_1049855748 23 Left 1049855738 8:144860702-144860724 CCCTTGAGTTGGTTACACGGAGA No data
Right 1049855748 8:144860748-144860770 GGTTGATAAGAGGTGTTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049855738 Original CRISPR TCTCCGTGTAACCAACTCAA GGG (reversed) Intergenic
No off target data available for this crispr