ID: 1049855955

View in Genome Browser
Species Human (GRCh38)
Location 8:144862015-144862037
Sequence TCCTCACACATATTATCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049855955_1049855956 -3 Left 1049855955 8:144862015-144862037 CCGGGGGATAATATGTGTGAGGA No data
Right 1049855956 8:144862035-144862057 GGAGAATAGAAGCAACAGTGTGG No data
1049855955_1049855958 23 Left 1049855955 8:144862015-144862037 CCGGGGGATAATATGTGTGAGGA No data
Right 1049855958 8:144862061-144862083 TTCAGTAGTAGTAGTAGTGGTGG No data
1049855955_1049855957 20 Left 1049855955 8:144862015-144862037 CCGGGGGATAATATGTGTGAGGA No data
Right 1049855957 8:144862058-144862080 CTTTTCAGTAGTAGTAGTAGTGG No data
1049855955_1049855959 27 Left 1049855955 8:144862015-144862037 CCGGGGGATAATATGTGTGAGGA No data
Right 1049855959 8:144862065-144862087 GTAGTAGTAGTAGTGGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049855955 Original CRISPR TCCTCACACATATTATCCCC CGG (reversed) Intergenic
No off target data available for this crispr