ID: 1049855956

View in Genome Browser
Species Human (GRCh38)
Location 8:144862035-144862057
Sequence GGAGAATAGAAGCAACAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049855953_1049855956 2 Left 1049855953 8:144862010-144862032 CCAAACCGGGGGATAATATGTGT No data
Right 1049855956 8:144862035-144862057 GGAGAATAGAAGCAACAGTGTGG No data
1049855955_1049855956 -3 Left 1049855955 8:144862015-144862037 CCGGGGGATAATATGTGTGAGGA No data
Right 1049855956 8:144862035-144862057 GGAGAATAGAAGCAACAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049855956 Original CRISPR GGAGAATAGAAGCAACAGTG TGG Intergenic
No off target data available for this crispr