ID: 1049855959

View in Genome Browser
Species Human (GRCh38)
Location 8:144862065-144862087
Sequence GTAGTAGTAGTAGTGGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049855955_1049855959 27 Left 1049855955 8:144862015-144862037 CCGGGGGATAATATGTGTGAGGA No data
Right 1049855959 8:144862065-144862087 GTAGTAGTAGTAGTGGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049855959 Original CRISPR GTAGTAGTAGTAGTGGTGGT AGG Intergenic
No off target data available for this crispr