ID: 1049860290

View in Genome Browser
Species Human (GRCh38)
Location 8:144893672-144893694
Sequence CACCTCTGCCAGGTTTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049860290_1049860297 12 Left 1049860290 8:144893672-144893694 CCCCTGGAAACCTGGCAGAGGTG 0: 1
1: 0
2: 1
3: 33
4: 289
Right 1049860297 8:144893707-144893729 CTCTACGGACCAATCACACCTGG No data
1049860290_1049860298 13 Left 1049860290 8:144893672-144893694 CCCCTGGAAACCTGGCAGAGGTG 0: 1
1: 0
2: 1
3: 33
4: 289
Right 1049860298 8:144893708-144893730 TCTACGGACCAATCACACCTGGG No data
1049860290_1049860296 -3 Left 1049860290 8:144893672-144893694 CCCCTGGAAACCTGGCAGAGGTG 0: 1
1: 0
2: 1
3: 33
4: 289
Right 1049860296 8:144893692-144893714 GTGGATGGTCATTCTCTCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049860290 Original CRISPR CACCTCTGCCAGGTTTCCAG GGG (reversed) Intronic
900288777 1:1915013-1915035 CAACTGTGCCTGGCTTCCAGCGG + Exonic
900597205 1:3486031-3486053 CAGCTGTGCCAGGATTCCTGGGG + Intergenic
901462155 1:9398290-9398312 AGCCTCTGCCAGGATCCCAGTGG + Intergenic
902329674 1:15725190-15725212 CACCCCTGTCAGGTTTCCCTGGG + Intronic
903869464 1:26423044-26423066 CACCTCTGCTGGGATTACAGGGG + Intronic
903959314 1:27046738-27046760 TGCCTTTTCCAGGTTTCCAGGGG - Intergenic
907847087 1:58218747-58218769 AACCTCTGCATGTTTTCCAGAGG + Intronic
909250241 1:73344312-73344334 AACCTCTGCCAAGATTTCAGAGG + Intergenic
909269178 1:73600965-73600987 AACCTCTGCCAAGATTTCAGAGG - Intergenic
909733968 1:78932977-78932999 CACCTCTGGTAGAATTCCAGAGG - Intronic
910779103 1:90908198-90908220 TACTTCTGCCAGGTGTCTAGGGG - Intergenic
911013522 1:93307158-93307180 CACCTCTGCCAAATTTAGAGTGG - Intergenic
912180224 1:107210159-107210181 CTCCTCTGCTTGGTCTCCAGTGG - Intronic
912432401 1:109635626-109635648 CAGCTCTCCCATGTTGCCAGGGG - Intergenic
913709994 1:121473204-121473226 AACCTCTGCCTAGATTCCAGAGG - Intergenic
917217225 1:172690977-172690999 AACCTCTGGCAGGCTTCCATAGG - Intergenic
917290844 1:173471023-173471045 CACCTCTGCCTAGATTTCAGAGG + Intergenic
918887533 1:190214569-190214591 CACACCTGCCAGGATTCCATTGG - Intronic
920597938 1:207291861-207291883 AACCTCTGCCTGATTTTCAGAGG + Intergenic
920684228 1:208096809-208096831 CACCTCTGTCAGGTTCCCAAAGG + Exonic
920940827 1:210480663-210480685 GACAGCTGCCAGGTTTCTAGAGG - Intronic
921013832 1:211169042-211169064 CACCTCTGCCTAGATTTCAGAGG - Intergenic
923034931 1:230279123-230279145 CACCTGTGGCTGGTTTCCTGTGG + Intronic
924767505 1:247047351-247047373 AACCTCTGCCACAATTCCAGAGG - Intronic
1066452515 10:35543802-35543824 CCCCACTGCCAGGTCTCCAGAGG - Intronic
1067476602 10:46571495-46571517 CATCTCTGCCAACTTTCCAGTGG + Intergenic
1067618136 10:47770286-47770308 CATCTCTGCCAACTTTCCAGTGG - Intergenic
1067936237 10:50614587-50614609 CACCTCTGCCAGAGTTTCTGAGG - Intronic
1069161746 10:65101409-65101431 CCCCTCTGAGAAGTTTCCAGAGG + Intergenic
1069334188 10:67328546-67328568 TCCCCCTGCCAGGGTTCCAGAGG + Intronic
1069340406 10:67402840-67402862 CACCTTTGCCAGGGATCCTGTGG - Intronic
1070728340 10:78807740-78807762 CACCTCTTCCAGGTTCCTAATGG - Intergenic
1071086375 10:81872951-81872973 CACCACTGCCAGTATTCCTGTGG - Intergenic
1072183723 10:93014209-93014231 AGCCTGTGCCAGGATTCCAGGGG + Exonic
1072850192 10:98882024-98882046 CACCTCTGCTAGCTTACCATTGG - Intronic
1074704813 10:116121264-116121286 CTCCCCTGCCAGGTTTCCTCTGG - Intronic
1076797146 10:132803913-132803935 CACCTCTGTCCTGTTCCCAGGGG - Intergenic
1078048638 11:7941909-7941931 CGACTCTTCCAGGTTTCCATAGG + Intergenic
1078103848 11:8346217-8346239 CTCCTCTCCCTGGATTCCAGTGG - Intergenic
1078379704 11:10829160-10829182 CACCTCTGCCTAGATTTCAGAGG - Intronic
1078454557 11:11465125-11465147 CACCTCGCCCAGGTTACCAGTGG - Intronic
1078621832 11:12915342-12915364 CCCCACAGCCAGGTCTCCAGAGG + Intronic
1080982385 11:37423979-37424001 AACCTCTGCCTGGATTTCAGAGG - Intergenic
1081108289 11:39100200-39100222 AACCTCTGCCTGGATTTCAGAGG - Intergenic
1081386629 11:42480246-42480268 CACCTCTGCCTAGATTTCAGAGG + Intergenic
1081529522 11:43948287-43948309 CCCCTCTGCTATTTTTCCAGAGG - Intergenic
1081775850 11:45675472-45675494 CACCTCTGCCAGGTTCTCACTGG + Intergenic
1083758516 11:64803651-64803673 GACCTCTGGGAGGTTCCCAGAGG + Exonic
1086229628 11:84552691-84552713 GACCTGTGCCAGGTATTCAGTGG + Intronic
1087058752 11:93958268-93958290 CTCCTCTTCAAGGTATCCAGTGG - Intergenic
1087337570 11:96863766-96863788 GAGGTCTGCCAGGGTTCCAGAGG + Intergenic
1089165988 11:116477032-116477054 CACCCCTGCCAGATTTCCAAGGG - Intergenic
1091548959 12:1523554-1523576 CACCTGTGCCAGGTGACCAGAGG - Intergenic
1092737323 12:11594851-11594873 CAGCTCTACCTGGGTTCCAGTGG - Intergenic
1092761222 12:11812965-11812987 CACCGCAGCCAGGGTTCCTGGGG - Intronic
1093076160 12:14760929-14760951 AACCTCTGCCTAGTTTTCAGAGG + Intergenic
1093641967 12:21538292-21538314 CACCTATATCAGGTTTCCAGAGG - Intronic
1093682901 12:22023616-22023638 AACCTCTGCCAAGATTTCAGAGG + Intergenic
1094798471 12:34002477-34002499 AACCTCTGCCTGGATTTCAGAGG - Intergenic
1096455566 12:51782379-51782401 CACCTTTGCATGTTTTCCAGAGG + Intronic
1097161791 12:57051477-57051499 CAGCTCTGCCAGGTTTGCAGTGG - Intergenic
1098250147 12:68560774-68560796 GACCTCTGCTGGGTTTCCTGGGG - Intergenic
1098676354 12:73294414-73294436 AACCTCTGCCTGGATTTCAGAGG + Intergenic
1101432025 12:104634682-104634704 CACCTCTTCTAGGTGTCAAGAGG + Intronic
1102578260 12:113870916-113870938 CACATCTACATGGTTTCCAGAGG + Intronic
1103780732 12:123397167-123397189 CTCCGCTGCCATGTTTGCAGAGG + Intronic
1103917978 12:124385695-124385717 CTCCTCTCCCAGCTTCCCAGAGG + Intronic
1104005054 12:124885945-124885967 CACCTCTTCCAGCTTCCAAGGGG + Intergenic
1104270084 12:127275527-127275549 CACATCTGCCTGGTTTTCTGTGG - Intergenic
1105447403 13:20469751-20469773 GACCTTTGACAGGTTTCCTGGGG - Intronic
1107140928 13:36998379-36998401 CCACTCTGCCATCTTTCCAGAGG - Intronic
1107188363 13:37549895-37549917 AACCTCTGCCTAGTTTTCAGAGG + Intergenic
1109494214 13:63146981-63147003 AACCTCTGCCTGGATTTCAGGGG - Intergenic
1110056930 13:70985509-70985531 AACCTCTGCCTGGATTTCAGAGG - Intergenic
1111336847 13:86836520-86836542 AACCTCTGCCTGGATTTCAGAGG - Intergenic
1111780846 13:92721820-92721842 CACCTCTTCCAGGTTTAATGAGG + Intronic
1113697637 13:112357479-112357501 GACCACTGCCAAATTTCCAGTGG + Intergenic
1114948410 14:27715958-27715980 AACCTCTGCCTAGTTTTCAGAGG + Intergenic
1115803712 14:37026755-37026777 CATCTCTTCCAGGTTTTTAGAGG - Intronic
1115932138 14:38508795-38508817 AACCTCTGCCTGGATTTCAGAGG - Intergenic
1116699500 14:48221576-48221598 GACCTCTGCCATTTTTTCAGTGG + Intergenic
1117102947 14:52369240-52369262 CACCTCTGCCTGGAAACCAGTGG - Intergenic
1118431900 14:65727363-65727385 AACCTCTGCCTGGATTTCAGAGG - Intronic
1118828869 14:69410283-69410305 CAATTCTGCCATGTTGCCAGGGG - Intronic
1119450144 14:74702309-74702331 AACCTCTGCCTGGATTTCAGAGG - Intronic
1119840549 14:77789605-77789627 CACCTCCTGCAGTTTTCCAGTGG - Intergenic
1120267705 14:82272561-82272583 CAGCTCTGCCTGGATTCCAAAGG + Intergenic
1121049713 14:90812470-90812492 CATCTCAGCAAGGTGTCCAGGGG - Intronic
1122724276 14:103740100-103740122 GAGCTCTTCCAGGTTTCCATTGG + Exonic
1123574694 15:21655611-21655633 CTCCTGTGCCAGGATTGCAGAGG - Intergenic
1123611308 15:22098107-22098129 CTCCTGTGCCAGGATTGCAGAGG - Intergenic
1128409841 15:67384317-67384339 CCCTTCTGCTACGTTTCCAGTGG + Intronic
1128450499 15:67803493-67803515 CACACCTGCCAGGGTCCCAGGGG + Intronic
1128619963 15:69140480-69140502 CTCCTCTGCCAGGTTTGCGGTGG - Intergenic
1128670677 15:69572674-69572696 CACCTTTCCCAGTTTGCCAGGGG - Intergenic
1129187898 15:73921652-73921674 CAGACCTGCCAAGTTTCCAGTGG - Intergenic
1129812784 15:78524215-78524237 AACCTCTGCCTGGATTTCAGAGG - Intronic
1130742478 15:86615652-86615674 CACCCATGCCAGCTGTCCAGAGG - Intronic
1132026852 15:98411292-98411314 CGGCTCTGCCAGGCTTACAGGGG + Intergenic
1132811205 16:1798678-1798700 AACCTCTGCCTGGATTTCAGAGG + Intronic
1134056865 16:11175521-11175543 GAACTCTGCCAGGTTTTCATTGG - Intronic
1134320333 16:13156985-13157007 GCCCTCAGCCAGGTTTCCAAAGG - Intronic
1135396080 16:22132631-22132653 CATTTCTGGCAGGCTTCCAGGGG + Intronic
1136549783 16:30976794-30976816 CACCTCTGCCACCTCCCCAGGGG - Intronic
1137396133 16:48117258-48117280 CACCTCAGTCAGGTCTCCATAGG + Exonic
1137407729 16:48203225-48203247 CACCTCTGTCATGTCTCCAAAGG + Exonic
1141027681 16:80563460-80563482 CTCCTCTGCCAGTTTTCCCTGGG + Intergenic
1142215015 16:88825807-88825829 CACTTGTGCCAGGTCTCGAGAGG + Intronic
1143010855 17:3865526-3865548 AACCTCTGCCAGGCTGCCAAGGG + Exonic
1144955794 17:19018219-19018241 CACCACAGCCAGGGTTCCAGCGG + Intronic
1147135963 17:38434364-38434386 CTCCTCGGCCAGATTCCCAGCGG - Intronic
1147834412 17:43319763-43319785 AACCTCTGCCAAGATTTCAGAGG - Intergenic
1149663269 17:58347682-58347704 CAGTTTTGCCAGCTTTCCAGTGG - Intronic
1150391271 17:64791099-64791121 CACCTCTGCTGGGTTTCTGGGGG - Intergenic
1151669247 17:75563004-75563026 CCCCTCGCCCAGGTTGCCAGAGG + Exonic
1155764092 18:29605751-29605773 AACCTCTGCCAAGATTTCAGAGG + Intergenic
1157550027 18:48575070-48575092 CGCCTCTGCCAGGACTCCTGGGG + Intronic
1157568206 18:48694378-48694400 CTCCACTGCCAGGGTTCCTGTGG - Intronic
1158071445 18:53475608-53475630 AACCTCTGCCTGGATTTCAGAGG + Intronic
1159395064 18:67846213-67846235 TACTGCTGCCAGGATTCCAGAGG - Intergenic
1161136755 19:2624607-2624629 CACCTCTGTCTGGTTGCCGGTGG + Intronic
1163029794 19:14536933-14536955 CACATCTGCCCCGTGTCCAGAGG - Intronic
1163791113 19:19306571-19306593 GACCTCTGTCAGGTTTCCCAGGG - Intronic
1165185639 19:34018707-34018729 CACCTTTATCAGGTTTCCAGGGG - Intergenic
1165435278 19:35791786-35791808 CACATCTGTCTGGGTTCCAGGGG + Intergenic
1167217448 19:48173980-48174002 CACCTCTTCCGGTGTTCCAGTGG - Intronic
925817032 2:7763669-7763691 AACCTCTGCCTGGATTTCAGAGG - Intergenic
927653143 2:24924307-24924329 CACCTTTGCCAGCCCTCCAGTGG - Intergenic
927988197 2:27428557-27428579 CACCGCCGGCAGGTTTCCATTGG - Exonic
932000365 2:67879242-67879264 CATCTCAGCAAGGATTCCAGGGG - Intergenic
932160812 2:69457677-69457699 CACCTCTGCTGAGTTTGCAGAGG - Intergenic
932346039 2:70995554-70995576 CACCTCTGGGAGGGTTCCTGAGG + Intergenic
933746742 2:85577340-85577362 CAGCCCTCCGAGGTTTCCAGAGG - Intronic
935653655 2:105403576-105403598 CACTTCTAACAGGTTTGCAGGGG - Intronic
936161807 2:110089087-110089109 AACCTCTGCCATGATTTCAGAGG + Intronic
936182856 2:110282267-110282289 AACCTCTGCCATGATTTCAGAGG - Intergenic
937094158 2:119224643-119224665 GCCCTCTGCCAGGGCTCCAGCGG - Intronic
937993392 2:127675948-127675970 CCCAGCTCCCAGGTTTCCAGGGG + Intronic
940437131 2:153668732-153668754 CACTGCTGCCAGGAATCCAGAGG - Intergenic
941688845 2:168477086-168477108 CACCTCTTCCTGGTTTGCAGAGG + Intronic
941761271 2:169246780-169246802 CACATCTGCCATTTTTACAGGGG + Exonic
942251035 2:174047918-174047940 CCGCTCTGCCAGGATCCCAGTGG - Intergenic
943960119 2:194253938-194253960 CACCTGTGCCTGGTTCCCACTGG - Intergenic
947263674 2:228252522-228252544 TCCTTCTGCCAGGATTCCAGAGG + Intergenic
947573475 2:231253613-231253635 CACTTCAGCCAGGTCCCCAGCGG - Intronic
948260737 2:236602719-236602741 CACCTCTGCCTGGACCCCAGGGG + Intergenic
948311400 2:236989614-236989636 CATCTACCCCAGGTTTCCAGAGG - Intergenic
948685996 2:239670092-239670114 CACCTGTGGCAGCTTTGCAGCGG - Intergenic
949045085 2:241869012-241869034 CACCTCTGCCAGGAGGGCAGGGG + Intergenic
1168978594 20:1986463-1986485 CACCTCTGCCCTGTGTCCACTGG + Intronic
1169857990 20:10124216-10124238 AACCTCTGCCTGGATTTCAGAGG - Intergenic
1170762924 20:19266692-19266714 CACATTTGGCAGGTTTGCAGGGG + Intronic
1172217001 20:33242704-33242726 CACCTCTGTCAGCTTTTCTGTGG - Intronic
1172355094 20:34274406-34274428 CCCCTCTGCCTGGTTTTCAGTGG - Intergenic
1172759552 20:37312411-37312433 AGCCTCTCCCAGGTTTCCTGGGG - Intronic
1174388376 20:50200683-50200705 CACCTTTGCCAGCCTTCCTGGGG + Intergenic
1177873026 21:26596331-26596353 CAACAGTGCCAGGGTTCCAGAGG - Intergenic
1179888734 21:44325512-44325534 CACCCCTGCCAGGCCTCCCGCGG + Intronic
1179940430 21:44636225-44636247 CAACCCTGCCGGGTTTCCAGGGG + Intronic
1181557578 22:23680525-23680547 CACCTTTTCCAGGTTTCCAAGGG + Intergenic
1183185478 22:36289255-36289277 CATCTCTGCCAAGTATGCAGAGG - Exonic
1184145771 22:42609438-42609460 CACCTATGCCAGGTTCCCGTAGG - Intronic
949770355 3:7570874-7570896 AACCTCTGCCTGGATTTCAGAGG - Intronic
950217779 3:11171642-11171664 CATCTTTGCCAGGATGCCAGAGG - Intronic
951324577 3:21286564-21286586 AACCTCTGCCTGGATTTCAGAGG + Intergenic
951821567 3:26819662-26819684 CATATCTGCCAGGTTTACAATGG + Intergenic
952616241 3:35277028-35277050 CACCTGAGCAAGGTATCCAGAGG + Intergenic
952966348 3:38623435-38623457 CACCTCTGCAAGGCCTGCAGAGG + Intronic
953983918 3:47427042-47427064 AAACTCTCCCAAGTTTCCAGGGG + Intronic
954234345 3:49244797-49244819 GACCCCAGCCTGGTTTCCAGTGG + Intronic
954315658 3:49799972-49799994 GACCTCTGGCAGGCTTCCAGAGG + Intergenic
954522725 3:51243326-51243348 TCCTTCTGCCAGGGTTCCAGAGG + Intronic
954686561 3:52373246-52373268 CCCCTTTTCCAGGCTTCCAGAGG - Intronic
954911814 3:54117110-54117132 AACCTCTGCCTGGATTTCAGAGG + Intergenic
955465257 3:59230371-59230393 AACCTCTGCCTGGATTTCAGAGG - Intergenic
955737487 3:62054918-62054940 CACCACTTCCATGTTTCCATGGG + Intronic
957988174 3:87597237-87597259 AACCTCTGCCTAGTTTTCAGAGG - Intergenic
958435748 3:94093545-94093567 CACCTCTATCAGGTCTCTAGGGG - Intronic
960502612 3:118455309-118455331 CACCTTTGCCAGGAATCCTGAGG + Intergenic
961077063 3:123992152-123992174 CTCCGCTGCCAGGTCACCAGGGG + Intronic
961307513 3:125969148-125969170 CTCCGCTGCCAGGTCACCAGGGG - Exonic
961455073 3:127019996-127020018 CTCCTCTGCAAGGTTCCCACAGG - Intronic
961554360 3:127688107-127688129 CACCTCTGCCTGCTTCCCAGAGG - Intergenic
961926856 3:130490414-130490436 CACTTCTGTCAGGATCCCAGGGG - Intergenic
962646415 3:137445098-137445120 AACCTCTGCCTAGATTCCAGGGG - Intergenic
962875172 3:139530641-139530663 TACCTTTGCCAGCTTTACAGTGG - Intronic
963226618 3:142868958-142868980 CACCTGTGCCTGGATTCCAAAGG - Intronic
965404865 3:168255889-168255911 AACCTCTGCCTGGATTTCAGAGG - Intergenic
966912644 3:184568183-184568205 TACCTCTTTCAGGTTTCCACAGG - Intronic
967991488 3:195134752-195134774 CCTCTCTGCCAGGCTTCCAGAGG - Intronic
968438056 4:605412-605434 CACCTGTGCCGTGTTTCCAACGG + Intergenic
969057655 4:4412258-4412280 CACCCAGGCCAGGTATCCAGCGG - Intronic
969058044 4:4414195-4414217 CACCCAGGCCAGGTATCCAGCGG - Intronic
969325612 4:6442199-6442221 CACACAGGCCAGGTTTCCAGTGG + Intronic
970998070 4:22290891-22290913 CACCTCAGCTGGGTTTCCAATGG + Intergenic
971429174 4:26545886-26545908 GACTTGTGCCAGTTTTCCAGGGG + Intergenic
972475567 4:39446549-39446571 CACCGCGGACAGGTTGCCAGTGG - Exonic
972563240 4:40247120-40247142 CCCCTCTGCCTGGTTTGCAATGG + Intergenic
972679946 4:41295681-41295703 CACAGCCGCCAAGTTTCCAGGGG - Intergenic
974665189 4:64952364-64952386 TACCTCTCCCAGGTCTCCTGGGG - Intergenic
974723827 4:65774124-65774146 TCCTTCTGCCAGGATTCCAGTGG + Intergenic
974924276 4:68278012-68278034 AACCTCTGCCTAGATTCCAGAGG + Intergenic
975510946 4:75193518-75193540 TCCTTCTGCCAGGTTTCCAGGGG - Intergenic
975584207 4:75934162-75934184 TACCTCTGCCATGTCTCTAGAGG + Intronic
976635980 4:87286857-87286879 CACCTCTGCCTAGATTCTAGAGG + Intergenic
977807071 4:101313479-101313501 CATGTCTGCCATGTTTGCAGAGG - Intronic
978262235 4:106773717-106773739 AACCTCTGCCAAGATTTCAGAGG + Intergenic
978833654 4:113119986-113120008 CCCCTCTACCAAGTTGCCAGTGG + Intronic
981938443 4:150257506-150257528 CTCCTCGGCCCGGGTTCCAGCGG + Intergenic
982299884 4:153867780-153867802 AACCTCTGCCTAGTTTTCAGAGG + Intergenic
983206895 4:164919856-164919878 TACCCCTGCCAGCTTTTCAGAGG + Intergenic
983589838 4:169396451-169396473 AGCCTCTGCCAGGTTGCCACTGG + Intronic
983719705 4:170834438-170834460 CACCTTTGGCAGGCATCCAGTGG - Intergenic
984592789 4:181635545-181635567 ATCCTCTGACAGGTTTCCTGGGG - Intergenic
986659237 5:10044251-10044273 CACCTCTGACAGCTTCTCAGGGG - Intergenic
989966872 5:50475248-50475270 AACCTCTGCCTAGATTCCAGAGG + Intergenic
991085267 5:62643462-62643484 CAGCTCAGCCATGCTTCCAGGGG + Intergenic
991586898 5:68210903-68210925 AACCTCTGCCCGGATTTCAGAGG - Intergenic
996045853 5:118873092-118873114 CCCTTCTGCCAGGGATCCAGAGG - Intronic
996101970 5:119453217-119453239 AACCTCTGCCAAGACTCCAGTGG - Intronic
996245980 5:121264066-121264088 CCCTTCTGCCAGGATTCCAGAGG + Intergenic
996618098 5:125466191-125466213 CATCTCTGTTAGGGTTCCAGTGG - Intergenic
997213010 5:132088567-132088589 CAGCTCCTCCAGGATTCCAGTGG + Intergenic
997399207 5:133589478-133589500 CACTTCTTCCAGGATTCCACTGG - Intronic
997470242 5:134113471-134113493 CACCGCTGCCAGGGGTCCTGTGG + Intergenic
997706279 5:135956458-135956480 CACCTTTGCCATGTTTCATGGGG + Intergenic
998561592 5:143177461-143177483 CAGCTCTGCCAGGTTTTCTGTGG - Intronic
998945940 5:147339344-147339366 AACCTCTGCCTGGATTTCAGAGG + Intronic
999549603 5:152671763-152671785 CATCTCTGTCAGCATTCCAGAGG - Intergenic
999648158 5:153739228-153739250 CACCTCTGCCATTCTTCCACTGG + Intronic
1001284946 5:170416083-170416105 GACATCTGGGAGGTTTCCAGAGG - Intronic
1001561263 5:172670351-172670373 CACCGCTGCCAGGTCCCCAGGGG - Intronic
1001823002 5:174724601-174724623 CGCCGCTGCCGGGTTGCCAGCGG + Exonic
1002070631 5:176677161-176677183 CCCCACTTCCAGTTTTCCAGGGG + Intergenic
1002783572 6:384664-384686 CACTTCTGCCTGGCTTCCTGTGG - Intergenic
1002798982 6:503281-503303 CACCTCTGCCATGTGCCTAGTGG - Intronic
1003501055 6:6703116-6703138 CATCTCTGCAAGGTATCGAGGGG + Intergenic
1003767875 6:9261389-9261411 CACCTCTGCCTAGATTTCAGAGG - Intergenic
1004421714 6:15476347-15476369 CACCTCTGCCATGAGGCCAGAGG - Intronic
1005499606 6:26418316-26418338 AACCTCTGCCAAGATTTCAGAGG - Intergenic
1008337483 6:50324683-50324705 AACCTCTGCCTGGATTTCAGAGG - Intergenic
1010561579 6:77357740-77357762 CACATCTACCAGGAGTCCAGAGG - Intergenic
1010929595 6:81784974-81784996 CTCCTCTGCAAGGCTTCTAGTGG + Intergenic
1012604021 6:101134191-101134213 TACCTCTCCCAGGTGTCCAGGGG + Intergenic
1012732401 6:102899502-102899524 AACCTCTGCCTGGATTTCAGAGG - Intergenic
1012858885 6:104535079-104535101 CCCCTCCCCCAGGATTCCAGAGG + Intergenic
1013928606 6:115502827-115502849 AACCTCTGCCTGGATTTCAGAGG + Intergenic
1013992199 6:116265977-116265999 CCCTTCTGCCAGGGTTCCAGAGG + Intronic
1015868656 6:137753751-137753773 TGCCTCTTCCAGGTTTCCTGTGG - Intergenic
1017405925 6:154118153-154118175 CACATATGCCAGCTTTACAGTGG + Intronic
1018034068 6:159866830-159866852 CACCTCTGCCCAGCTTCCTGGGG + Intergenic
1019731766 7:2632791-2632813 TCCCACTGCCAGGCTTCCAGTGG + Intronic
1021153696 7:17182890-17182912 CACCTCTGCCTCTGTTCCAGAGG - Intergenic
1021606379 7:22413389-22413411 CCCATCTGCCAGGCTACCAGAGG - Intergenic
1021911827 7:25393079-25393101 CACAGCTGCCAGGCTTTCAGTGG + Intergenic
1022910429 7:34895581-34895603 AACCTCTGCCTGGATTTCAGAGG + Intergenic
1023846191 7:44121966-44121988 CACCTTTGCCCGGGTGCCAGTGG - Exonic
1025744149 7:64228105-64228127 CACTTCTGTGAGGTGTCCAGAGG + Intronic
1025766851 7:64463993-64464015 CACCACTTCTAGGCTTCCAGGGG - Intergenic
1026169985 7:67945447-67945469 CAGCTCTTCCAGGGTTGCAGAGG + Intergenic
1027554694 7:79648523-79648545 CCCTTCAGCCAGGATTCCAGAGG + Intergenic
1035176839 7:157057449-157057471 CATCTCTGCTAGGCTTACAGGGG + Intergenic
1038492500 8:27981020-27981042 CACCTCTGCAAGCTTTGCAGGGG + Intronic
1039121947 8:34157513-34157535 AACCTCTGCCTGGATTTCAGAGG + Intergenic
1040822144 8:51573401-51573423 CTCCTCTGACACCTTTCCAGTGG - Intronic
1042548514 8:69972399-69972421 CGGCTCAGCCAGGTTCCCAGTGG - Intergenic
1043662552 8:82762869-82762891 TACCACTGCCAGTTTTCCAGTGG - Intergenic
1046327290 8:112665939-112665961 CTGCTCTGCTAGGTTTCAAGAGG - Intronic
1046400409 8:113697534-113697556 AACCTCTGCCTGGATTTCAGAGG + Intergenic
1046606053 8:116373432-116373454 AACCTCTGCCTGGTTTTCAGAGG - Intergenic
1046786476 8:118272150-118272172 AACCTCTGCCTGGATTTCAGAGG - Intronic
1046998072 8:120546236-120546258 AACCTCTTCCAGGTCTCCTGCGG - Intronic
1047311781 8:123698217-123698239 CATCTCTTCCAGTCTTCCAGAGG - Intronic
1049017540 8:139931459-139931481 CACCACAGACAGGGTTCCAGTGG - Exonic
1049247940 8:141572620-141572642 CACCGCAGCCAGGTACCCAGAGG - Intergenic
1049499974 8:142957128-142957150 TACCTCTGCCAAGTATCCACCGG - Intergenic
1049860290 8:144893672-144893694 CACCTCTGCCAGGTTTCCAGGGG - Intronic
1050127171 9:2368786-2368808 CACCTCTTCCAATTTTGCAGAGG - Intergenic
1050514067 9:6424166-6424188 CAGCTCTCCCAGGTATCCATAGG - Intronic
1051224052 9:14880138-14880160 CACCTCTTCCTGGTTTGCAGAGG - Intronic
1052179371 9:25505570-25505592 CACCTCTGCCTAGATTTCAGAGG - Intergenic
1052705402 9:31988588-31988610 AACCTCTGCCTGGATTTCAGAGG - Intergenic
1053251248 9:36575665-36575687 CATCTCTGCTAGTTTTCCAGAGG + Intronic
1055174425 9:73299705-73299727 AACCTCTGCCCAGATTCCAGAGG - Intergenic
1055701282 9:78948190-78948212 AACCTCTGCCAAGATTTCAGAGG + Intergenic
1056455410 9:86754872-86754894 CACCTGCCCCTGGTTTCCAGGGG + Intergenic
1056641983 9:88379215-88379237 CACAGCTGCCTGGCTTCCAGCGG + Intergenic
1057374875 9:94511640-94511662 CACCTTTATTAGGTTTCCAGGGG + Intergenic
1057587650 9:96343901-96343923 CACCTGTTGCAGGTCTCCAGTGG + Exonic
1057979808 9:99649807-99649829 CCCTCCTGCCAGGATTCCAGAGG - Intergenic
1059999607 9:119946322-119946344 TACCTCTGCTAGCTTTTCAGGGG + Intergenic
1060629593 9:125143544-125143566 CGCCTCTGCCAGGCTTGCCGCGG + Intergenic
1060962739 9:127692693-127692715 CACCCCTTCCCGGTGTCCAGGGG + Exonic
1061429262 9:130520939-130520961 CTCCTCTGTGAGGCTTCCAGGGG + Intergenic
1061776820 9:132971226-132971248 CACCCCTGCCAGGGTTTCTGGGG + Intronic
1061791919 9:133063514-133063536 CACCTGTGCCAGGTTCCAGGTGG - Intronic
1061821375 9:133228693-133228715 CACCTGTGCTAGGTCCCCAGGGG - Intergenic
1061834066 9:133317670-133317692 CACCTGTGCCAGGTCCCCGGGGG + Intergenic
1062109355 9:134773554-134773576 CACCTGCTCCAGGGTTCCAGAGG + Intronic
1062171310 9:135136375-135136397 CACCTCTCCCTGGTCTCCTGAGG - Intergenic
1062204470 9:135328540-135328562 CAGCTCTCCCAGGCTGCCAGGGG + Intergenic
1187438469 X:19294559-19294581 CTCCTCTGCCAGGGAACCAGAGG - Intergenic
1187492246 X:19762892-19762914 CTCCACTCGCAGGTTTCCAGTGG - Intronic
1187983302 X:24782791-24782813 CACTTCTACCATGTTTCCACAGG + Intronic
1188712334 X:33415915-33415937 CACTTCTGCCAGTTTCCCATAGG - Intergenic
1188797281 X:34482028-34482050 TCCTTCTGCCAGGATTCCAGAGG + Intergenic
1189678229 X:43486449-43486471 CTCCTCTGCCTGGATTCCAGAGG - Intergenic
1189778488 X:44491473-44491495 CACCTCTGCCAGGTTTAAGGAGG - Intergenic
1190412664 X:50152422-50152444 CACGTCTGCCAGTTTTTCAAGGG - Intergenic
1192935204 X:75851379-75851401 TTCTTCTGCCAGGATTCCAGAGG + Intergenic
1193265595 X:79464492-79464514 CACCCATGCCAGGCTTCCACGGG - Intergenic
1193823426 X:86194615-86194637 TCCTTCTGCCAGGATTCCAGAGG - Intronic
1193887951 X:87006519-87006541 AACCTCTGCCTGGATTTCAGAGG - Intergenic
1194512537 X:94813753-94813775 GTCTTCTGCCAGGTTTCTAGGGG + Intergenic
1196010074 X:110877399-110877421 CACCTGTGCCTATTTTCCAGAGG - Intergenic
1196540387 X:116900439-116900461 AACCTCTGCCTGGATTTCAGAGG - Intergenic
1197020160 X:121677288-121677310 CACCTCTGCCATCTATCAAGAGG + Intergenic
1197089614 X:122521196-122521218 AACCTCTGCCTGGATTTCAGAGG - Intergenic
1197437744 X:126453066-126453088 AACCTCTGCCAAGATTTCAGAGG + Intergenic
1197578791 X:128256076-128256098 AACCTCTGCCAAGATTTCAGAGG - Intergenic
1198845668 X:140907679-140907701 GTCATCTGCCAGGTTTCCTGGGG + Intergenic
1199020317 X:142870621-142870643 AACCTCTGCCTGGGTTTCAGAGG + Intergenic
1199270183 X:145873472-145873494 TCCTTCTGCCAGGATTCCAGAGG + Intergenic
1200778136 Y:7188486-7188508 CACCTCTGGCAATTTTCCAGAGG - Intergenic