ID: 1049860386

View in Genome Browser
Species Human (GRCh38)
Location 8:144894291-144894313
Sequence CTGGGCAGACAGACGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049860386_1049860397 29 Left 1049860386 8:144894291-144894313 CCCAGCACCGTCTGTCTGCCCAG 0: 1
1: 0
2: 1
3: 27
4: 265
Right 1049860397 8:144894343-144894365 AGTGACTGTCCTCTGCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049860386 Original CRISPR CTGGGCAGACAGACGGTGCT GGG (reversed) Intronic
900027696 1:292289-292311 CTGGACAAACAGAGTGTGCTGGG - Intergenic
900041651 1:471731-471753 CTGGACAAACAGAGTGTGCTGGG - Intergenic
900063086 1:706708-706730 CTGGACAAACAGAGTGTGCTGGG - Intergenic
900425452 1:2576324-2576346 CAGGGCAGAGAGAGGGCGCTTGG + Intergenic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901209055 1:7514318-7514340 CAGGGCAGACAGGCAGTGCCTGG + Intronic
903269353 1:22178018-22178040 CTGGGCAGGCAGGGGGTGCGGGG - Intergenic
904037217 1:27565288-27565310 CTGGTCAGGCAGACCGTTCTAGG - Intronic
904913552 1:33953400-33953422 CAGGACAGACAGACTGTGCGAGG - Intronic
904923649 1:34028842-34028864 CTGAGATGACAGAAGGTGCTTGG - Intronic
906520853 1:46466247-46466269 CTGGACACACAGAAGGCGCTGGG + Intergenic
907306701 1:53517331-53517353 CTGGACAGACAGGTGGTGCTAGG - Intronic
907751816 1:57270058-57270080 GTGGGCAGACATCCAGTGCTCGG - Intronic
907834562 1:58096854-58096876 CTGGCCAGTCAGCCAGTGCTGGG - Intronic
908246844 1:62234060-62234082 CTGGGCGAACATAGGGTGCTGGG - Intergenic
909774538 1:79467375-79467397 CTGAACAGACAGACCGTGCTAGG - Intergenic
910278427 1:85472257-85472279 CTAGGCAGACAGACCTGGCTGGG + Intronic
916246845 1:162696797-162696819 CTGGGCAGACAGCGGGGGCAGGG - Intronic
916604845 1:166330941-166330963 CTGGGCAGGTAGAAGCTGCTTGG - Intergenic
917478512 1:175389476-175389498 CTGGGCAGACAGGCCTTGCTGGG + Intronic
918423807 1:184387979-184388001 CGAGGCAGCCAGAGGGTGCTTGG + Intronic
919369753 1:196708460-196708482 CTGGGCAGACAAACGCAGCTAGG + Intronic
920051239 1:203166248-203166270 CTGGGCTGGGAGAAGGTGCTTGG + Exonic
920185504 1:204156761-204156783 CTGGGAGGACAGATTGTGCTGGG - Exonic
920242416 1:204562672-204562694 CAGGGCAGACCGGCGGTGCTTGG - Intergenic
920343738 1:205292519-205292541 ATGGGCAGACAGACTGGGCGTGG - Intergenic
920701723 1:208223018-208223040 CTGAGGAGCCAGACGGTGGTAGG + Intronic
921449372 1:215286568-215286590 CTGGGCAAACACACACTGCTAGG - Intergenic
922260029 1:223931733-223931755 CTGGACAAACAGAGTGTGCTGGG - Intergenic
924341194 1:243034293-243034315 CTGGACAAACAGAGTGTGCTGGG - Intergenic
924775144 1:247111276-247111298 CGGGGGAGACAGCCGGTCCTAGG - Exonic
1063633400 10:7756533-7756555 CTGGGCAGGCAAAAGGAGCTTGG - Intronic
1065150833 10:22821559-22821581 CTGGACACACAGAAAGTGCTTGG + Intergenic
1065204064 10:23341733-23341755 CTGGGTAGAAAGATGGTGCCTGG - Intronic
1067402327 10:45988236-45988258 CTGGGCAGGCAGGCCTTGCTGGG - Intronic
1069601290 10:69709821-69709843 CTGGGCAGACAGAGGGCTCCCGG + Intergenic
1069832512 10:71289839-71289861 GTGGGCAGACATCCGGGGCTGGG + Intronic
1069953022 10:72032497-72032519 CTGGGCCGAAAGACGAGGCTGGG + Intergenic
1070964320 10:80520398-80520420 CTGTGCGGACAGCCGATGCTGGG - Exonic
1073321581 10:102619333-102619355 CTGGGGAGCCAGCGGGTGCTGGG - Intronic
1073325673 10:102643088-102643110 GCGGGCAGACAGACGGACCTCGG + Intergenic
1075096873 10:119477748-119477770 CTGGGCAGGTTGACGGTGCTGGG + Intergenic
1076761534 10:132608343-132608365 CTGTGCAGAGAGTGGGTGCTGGG + Intronic
1076865517 10:133164491-133164513 CTGGGCAGACAGACAGGCGTCGG + Intronic
1076967926 11:107959-107981 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1077461916 11:2715020-2715042 CTGGGCAGATTGCCGGTGGTTGG + Intronic
1078944935 11:16054928-16054950 CTGGGCAGCCAGGAGGTACTTGG - Intronic
1079261589 11:18887525-18887547 CAGGACGGACAGGCGGTGCTCGG + Intergenic
1080762165 11:35262166-35262188 CTGGGCAGACAGTCTGTCCCTGG - Intronic
1081668833 11:44932156-44932178 CTGGGGAGACGGCGGGTGCTGGG - Exonic
1082873345 11:57963853-57963875 ATGAGCAGACAGGCGGTGCCTGG - Intergenic
1083463208 11:62828928-62828950 CTGGGAATACAGGCGGTGCCAGG - Intronic
1083633019 11:64105400-64105422 CTGGGCAGACAGACCTGGGTTGG + Intronic
1084122142 11:67075893-67075915 CTGGACAGTCAGACTGTCCTGGG - Intergenic
1084359325 11:68659566-68659588 CCGGGCAGATGGACGGGGCTGGG + Intergenic
1084495430 11:69500637-69500659 CTGGCCAGACAGCAGGTGCAGGG + Intergenic
1084909030 11:72372805-72372827 CTGGGCACACAGTGGGTGCTGGG + Intronic
1085057093 11:73411394-73411416 CTGGGCATACAGATTCTGCTGGG + Exonic
1085348534 11:75783592-75783614 ATGGGCACACAGTAGGTGCTTGG + Intronic
1089130506 11:116208316-116208338 ATGGGCAGACAGGTGGTGGTAGG + Intergenic
1089697953 11:120227392-120227414 CAGGGCACACAGACTCTGCTAGG + Intronic
1091309615 11:134563152-134563174 CCGGGCAGGCAGGCAGTGCTTGG + Intergenic
1091452087 12:578830-578852 CTGGGAAGACAGGAGCTGCTGGG - Intronic
1091452224 12:579979-580001 CTGGGAAGACAGGAGCTGCTGGG + Intronic
1095734064 12:45537033-45537055 CTGGGTACACAGATAGTGCTCGG - Intergenic
1096463558 12:51836217-51836239 CAGGGCAGACAGGCGGGGCTGGG - Intergenic
1097309737 12:58105479-58105501 CTGTGTAGACAGATGATGCTGGG + Intergenic
1097870270 12:64596087-64596109 CTAGGCAGACAGGCCTTGCTGGG + Intergenic
1101760172 12:107651866-107651888 CAGGGCAGAGAGTGGGTGCTGGG + Intronic
1101922981 12:108947884-108947906 CTGTGAAGGCAGATGGTGCTGGG + Intronic
1102786815 12:115611760-115611782 CTGGGCAGCCAGTTGGTGCTGGG - Intergenic
1103936538 12:124480362-124480384 CTGGGCAGTCAGACACAGCTGGG + Intronic
1104920439 12:132287791-132287813 CTGGGCAAGCAGACGCGGCTTGG + Intronic
1105805562 13:23950009-23950031 CTGGGCAGCCAGGGGGTGCCAGG + Intergenic
1106124474 13:26889087-26889109 CTGGGAAGACAGAGGTTGCAGGG + Intergenic
1107392566 13:39982553-39982575 CTGGGCAGAGGGACACTGCTGGG - Intergenic
1107743464 13:43479736-43479758 ATGGGCAGAAAGATGGAGCTGGG - Intronic
1108854297 13:54774634-54774656 ATGGGCTGGCAGACTGTGCTTGG + Intergenic
1110630218 13:77698280-77698302 CTAGGCAGGCAGAAGGTGCCCGG - Intronic
1113589237 13:111486602-111486624 CTGGGAGGAGGGACGGTGCTGGG - Intergenic
1113814154 13:113159901-113159923 CTGTGGAGACGGACGGGGCTGGG + Intronic
1114710632 14:24774532-24774554 CTGGTGAGGCAGACGGTGATTGG + Intergenic
1117026659 14:51627548-51627570 CTGGGCAGAGATAGGCTGCTGGG + Intronic
1119754136 14:77102149-77102171 CTGGACAGACAGACCTTGCTGGG - Intronic
1120294553 14:82623388-82623410 CTAGGCAGACAGGCCTTGCTGGG - Intergenic
1122423845 14:101594144-101594166 CTGGGCAGAGAGAGAGGGCTGGG - Intergenic
1122572006 14:102710469-102710491 TTGGGTAGAAAGACGGTACTTGG + Intronic
1122572623 14:102717403-102717425 CTGAGCACACAGAGTGTGCTTGG - Intronic
1123487597 15:20755674-20755696 CTGGGCAGGCAGCCGGAGCCCGG + Intergenic
1123544089 15:21324732-21324754 CTGGGCAGGCAGCCGGAGCCCGG + Intergenic
1123708049 15:22964817-22964839 CTGGGCAGGCAGACGGGGCTGGG - Intronic
1124018463 15:25898430-25898452 GTGGGCTCACAGAAGGTGCTGGG + Intergenic
1124231086 15:27946987-27947009 CTGGACAGACAGGCCCTGCTGGG + Intronic
1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG + Intergenic
1125283032 15:38063403-38063425 CTGGGCACAGAGCCGGGGCTTGG - Intergenic
1126313097 15:47338959-47338981 CTGAACAGACAGACTTTGCTGGG + Intronic
1128135433 15:65259847-65259869 CTGGGCAGACACCCTGAGCTAGG - Intronic
1128176663 15:65562191-65562213 CTGGACAGACAGGCCTTGCTGGG - Intronic
1128958199 15:71972076-71972098 CTGGACAGACAGGCCTTGCTGGG + Intronic
1129055417 15:72816661-72816683 CTGGACAGACAGGCCTTGCTGGG - Intergenic
1129457260 15:75682607-75682629 CTGGGCAGACAGTCAGTGTCTGG + Exonic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1129722441 15:77885206-77885228 CTGGGGAGTCAGAGGGGGCTGGG + Intergenic
1132004818 15:98217616-98217638 CAGGGCACACAGTCGGTCCTGGG + Intergenic
1202952431 15_KI270727v1_random:52005-52027 CTGGGCAGGCAGCCGGAGCCCGG + Intergenic
1134648878 16:15892599-15892621 CTGAGCAGACAGGCTTTGCTGGG + Intergenic
1135069629 16:19340557-19340579 CTGAGCAGACAGGCCTTGCTGGG + Intergenic
1135264389 16:21010139-21010161 CTGGGCACACAGAAGGCACTTGG + Intronic
1142144333 16:88486559-88486581 CTGGGTACACAGTGGGTGCTAGG + Intronic
1142452754 16:90191180-90191202 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1142786640 17:2229414-2229436 CTGGGCAGCTAGACAGTGCAAGG - Intronic
1143324967 17:6092719-6092741 CTGAGCAGGCAGATGGGGCTGGG - Intronic
1143325143 17:6093674-6093696 CAGGGCAGACACACGGTGGTGGG + Intronic
1143895716 17:10134785-10134807 CTGGGCAGACAGTAGAAGCTCGG + Intronic
1144370367 17:14584594-14584616 CTGAGCAGACAGACCATGCTGGG - Intergenic
1144789380 17:17848913-17848935 ATGGGCAGACAGAGGTGGCTGGG - Intronic
1144848841 17:18233956-18233978 CCGGGCACACAGTGGGTGCTGGG - Intronic
1145888935 17:28401355-28401377 CTGGGCACAGAGAAAGTGCTGGG + Exonic
1147337579 17:39736916-39736938 CTGGGCAAACACAGGGTACTTGG - Intergenic
1147553264 17:41460156-41460178 CGTGGCACACAGACGGTGCGGGG + Exonic
1147583270 17:41638591-41638613 CTGGGTATACAGGGGGTGCTGGG - Intergenic
1147605519 17:41771932-41771954 GTGGGAAGACAGGCGGGGCTTGG - Intronic
1148073992 17:44925123-44925145 CTGTGCAGGCAGACGGCTCTTGG - Intronic
1148216794 17:45837719-45837741 CTGGGCAGGCAGATGGAGCCTGG + Intergenic
1149411350 17:56410705-56410727 GTTGGCAGAGAGACGGTGGTGGG - Intronic
1149869207 17:60167771-60167793 CTGGGAAGACACATGGAGCTAGG - Intronic
1151299876 17:73216311-73216333 CTGGGCAGACAGCAGGTGTTTGG + Intronic
1152566804 17:81103899-81103921 CTGGGCAGACATCCGCTGCAGGG - Exonic
1155200828 18:23516170-23516192 CTGGGCAGACAGGCTGTGAGAGG + Intronic
1156479124 18:37425178-37425200 CTGGGCAACCTGAAGGTGCTCGG + Intronic
1160233632 18:77068067-77068089 CTGGGCAGACAGGAGGGGATGGG + Intronic
1160644731 19:177582-177604 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1160895402 19:1399939-1399961 CTGGGCAGACACAGGGCGCCTGG + Intronic
1160990469 19:1858265-1858287 CTGGGCACCCAGACTGCGCTTGG + Intronic
1161280796 19:3444484-3444506 CTGAACAGACAGAGGATGCTTGG + Intronic
1161335048 19:3708516-3708538 CTGGGCAGGCAGCAGGTGCCAGG - Intronic
1162152356 19:8655458-8655480 CTGGGCAGACACCAGGTGCGGGG + Intergenic
1162515040 19:11142682-11142704 CTGGGCATCCAGCCAGTGCTGGG + Intronic
1162575693 19:11497559-11497581 CTGGGCACACAGTGAGTGCTGGG + Intronic
1163177226 19:15572939-15572961 CTGGGCAGACAGGGTGTCCTAGG + Intergenic
1166328640 19:42066206-42066228 CTGGGCAGGCAGCCGTTACTAGG + Intronic
925134061 2:1514438-1514460 CTGGGCAGACAGAGGGCACTGGG - Intronic
925144841 2:1574324-1574346 CAGGGCAGACAGGCGGTGAAGGG + Intergenic
925806481 2:7655468-7655490 CTGAGCAGAGAGACTTTGCTGGG - Intergenic
926662406 2:15481996-15482018 CTGGACAGACAGGCCTTGCTGGG + Intronic
927282398 2:21320775-21320797 CTGGGCAGATAGATTCTGCTTGG - Intergenic
927519293 2:23689441-23689463 CTGGGCAGACGGACAGTCCATGG - Intronic
928495025 2:31822819-31822841 CTGGGCAGAGGGACAGTGCCAGG - Intergenic
929789910 2:45014540-45014562 CTGGGCACCCAGACGTTGCAGGG - Intergenic
931089228 2:58867674-58867696 CTGAGCAGACAGGCCTTGCTGGG + Intergenic
931791468 2:65667503-65667525 CTGGGCAGAGGGACAGTGCCAGG + Intergenic
933806617 2:86002981-86003003 CTCTGCATACAGAGGGTGCTGGG - Intergenic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
935220926 2:101011691-101011713 CTGGGTATCCAGACAGTGCTTGG - Intronic
935265756 2:101392481-101392503 CTGAACAGACAGACCTTGCTGGG + Intergenic
936632330 2:114216754-114216776 CCTGGGAGACAGACCGTGCTGGG + Intergenic
937065010 2:119011348-119011370 CATGGCACACAGAAGGTGCTTGG + Intergenic
937352932 2:121178468-121178490 CTGTGCAGTCAGAAGGTGCCTGG + Intergenic
941640121 2:167978181-167978203 CTTGGCAGACAGAGGCTGCATGG + Intronic
946952540 2:224892747-224892769 CAGGGAAGGCAGACAGTGCTTGG + Intronic
948063557 2:235060280-235060302 CTGGGCACACAGAGGGTCCAAGG + Intergenic
948374772 2:237514135-237514157 CCAGGCAGACAGACCTTGCTAGG - Intronic
948468186 2:238162094-238162116 CTGGGCAGAAACTTGGTGCTTGG + Intronic
948705902 2:239792355-239792377 CTGGGAAGGCAGAAGGGGCTGGG - Intronic
1168774388 20:435787-435809 CTGGACAGACAGGCCTTGCTGGG - Exonic
1168832697 20:855509-855531 CTGGACATACAGTTGGTGCTTGG - Intronic
1169300465 20:4437729-4437751 CCTGGCACACAGTCGGTGCTGGG - Intergenic
1172656293 20:36540862-36540884 TTGGGCAGACAGGAGGTGCAGGG - Intergenic
1172658009 20:36548779-36548801 CTGTGCACACAGATGGTGTTGGG - Intronic
1175257762 20:57657315-57657337 CTGGGGAGAGTGACGGTGCCTGG - Intronic
1175738116 20:61401109-61401131 CTGGGCAGACGTACTGTCCTTGG + Intronic
1175754385 20:61520269-61520291 CTGGGCAGTCACCCTGTGCTGGG - Intronic
1176086174 20:63296568-63296590 CTGGGCAGACAGCGGCTGGTGGG - Intronic
1176280777 20:64308329-64308351 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1177181972 21:17753914-17753936 CTGGACAGACAGGCCGGGCTGGG + Intergenic
1178635163 21:34296141-34296163 CTGGGCATACAGCAGGTGGTAGG + Intergenic
1180938654 22:19642356-19642378 CTTAGGAGGCAGACGGTGCTTGG - Intergenic
1181167896 22:20993098-20993120 TGGGGCAGGCAGATGGTGCTGGG + Intronic
1181275415 22:21684942-21684964 ATGGGCAGGAAGACGGGGCTTGG - Intronic
1181728245 22:24826531-24826553 CTGGCCACACAGCAGGTGCTCGG - Intronic
1182148955 22:28015143-28015165 CCTGGCAGACAGCCAGTGCTTGG - Intronic
1182288375 22:29260854-29260876 CCGGGCAGACAGATGCAGCTGGG - Exonic
1182299056 22:29328011-29328033 CTGGGCCGAGAGATGGGGCTGGG - Exonic
1183696552 22:39426935-39426957 CTGTGCAGACAGGCAGTGCCTGG + Intronic
1184287267 22:43478696-43478718 CTGGGCAGCCAGATTGTGTTTGG + Intronic
949102827 3:166365-166387 CTGGGCTCACAGACTGTGCCAGG - Intergenic
949461639 3:4301186-4301208 CTGAGCAGACAGACAGTCCTGGG + Intronic
950118896 3:10468683-10468705 CAGGTCACTCAGACGGTGCTGGG + Intronic
952889713 3:38031727-38031749 CTGGGCCCACAGACGGCCCTGGG - Intergenic
953556958 3:43953491-43953513 ATGAGCAGAGAGACGGAGCTGGG + Intergenic
954212130 3:49103828-49103850 CTGGGGAGGCAGACGATGCCTGG + Intronic
954328157 3:49874904-49874926 CTGGGCAGACACCCCTTGCTAGG - Intergenic
954790599 3:53130378-53130400 ATGGGCAGCCAGGAGGTGCTGGG - Exonic
955345111 3:58155186-58155208 GTGGGCAGACAGAGGCTGGTTGG - Intronic
956916391 3:73876337-73876359 CTAGACAGACAGACCATGCTGGG - Intergenic
960006127 3:112782889-112782911 CTGAGCAGACAGCCCTTGCTGGG + Intronic
960829442 3:121830894-121830916 CTGAGCAGACAGGCCTTGCTGGG + Intronic
962286270 3:134087752-134087774 CTGGGCAGACAGGCCTTGTTAGG + Intronic
963192112 3:142484255-142484277 CTGAACAGACAGACCTTGCTGGG + Intronic
964483298 3:157162878-157162900 CTGGGCAGAGGGACAGTGCCAGG - Intergenic
966852914 3:184175512-184175534 CTGGGGAGACAGAGCCTGCTTGG - Intronic
968905215 4:3447712-3447734 CTGGGCAGACATGTGGTGCGGGG + Intronic
969117832 4:4883888-4883910 AGGGGCAGAACGACGGTGCTGGG + Intergenic
969349854 4:6592080-6592102 CTGTGCAGTCAGACGGCCCTGGG + Intronic
971254619 4:25002770-25002792 CTGGGCCTACAGCCTGTGCTGGG + Exonic
971664707 4:29467454-29467476 CAGGGCAGACAGGAGGAGCTGGG + Intergenic
978216365 4:106208986-106209008 CTGGCCAGGCAGGCTGTGCTTGG - Intronic
979261633 4:118654082-118654104 CTGGACAAACAGAATGTGCTGGG + Intergenic
983011267 4:162550576-162550598 CTGGGAAGACACCCGTTGCTAGG + Intergenic
983150205 4:164269248-164269270 CTGGACAAACAGAGTGTGCTGGG - Intronic
985041702 4:185897351-185897373 CTGGACAGACAGGCCTTGCTGGG + Intronic
985324712 4:188754672-188754694 GTGGGCAGGCTGACAGTGCTGGG - Intergenic
985796515 5:1966206-1966228 CTGGGCTGACAGGTGCTGCTGGG + Intergenic
986059490 5:4174579-4174601 CTCAGCAGAAAGACGGGGCTAGG + Intergenic
986705750 5:10453332-10453354 CTGGGTAGACAGGAGGTGCTCGG + Intronic
986728824 5:10619856-10619878 TCCGGCAGACAGATGGTGCTGGG - Intronic
987362590 5:17120654-17120676 CGAGGCAAACAGAAGGTGCTAGG - Intronic
987661916 5:20888929-20888951 CTGGGCAGACAGGCCTTGCTGGG - Intergenic
988761671 5:34316390-34316412 CTGGGCAGACAGGCCTTGCTGGG + Intergenic
990433001 5:55755898-55755920 CTGGACAGAGGGACGGTGCCTGG - Intronic
991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG + Intronic
996198723 5:120642951-120642973 ATGGGCAGAAAGACTGTGTTAGG - Intronic
997597536 5:135117091-135117113 CTGGGCACACAGCTGGTGCCTGG - Intronic
998093060 5:139382143-139382165 CTGGGCAGGCAGCCGGTTCCAGG - Intronic
998168354 5:139857217-139857239 CTGGGAAGATAGACGGGCCTGGG + Intronic
999253759 5:150197918-150197940 CTGGGCACACAGTGGGTCCTGGG + Intronic
1001236505 5:170034342-170034364 CTGGGGAGAAAGACTGTGCTGGG - Intronic
1002193156 5:177489325-177489347 GTGGGCAGACAGGTGGGGCTGGG + Intronic
1002351663 5:178588282-178588304 CTGGGCAGGCAGCCACTGCTGGG - Intronic
1002732193 5:181347198-181347220 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1002752342 6:126906-126928 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1004860180 6:19796136-19796158 CTAGCCAGACAGAAGATGCTTGG + Intergenic
1005094964 6:22104452-22104474 CTGGGCAGACAGTGAGTCCTGGG - Intergenic
1005097165 6:22129694-22129716 CTGGGCAGACACATGGTAGTGGG + Intergenic
1005652580 6:27898034-27898056 CTGGACAGACAGGCCTTGCTGGG + Intergenic
1006591892 6:35164288-35164310 CTGGGCAGCCAGAGGGGTCTGGG + Intergenic
1009031398 6:58063069-58063091 CTGGACAGACAGGCCTTGCTGGG - Intergenic
1009192714 6:60648803-60648825 CTGGGCATAAAGACAGGGCTAGG + Intergenic
1009207250 6:60817522-60817544 CTGGACAGACAGGCCTTGCTGGG - Intergenic
1011489251 6:87874024-87874046 CTGAGCAGACAGGCTTTGCTGGG - Intergenic
1012902491 6:105022507-105022529 CTAGACAGACAGACCTTGCTGGG - Intronic
1013661907 6:112306630-112306652 CTGGGCACAGAGCAGGTGCTCGG + Intergenic
1014249332 6:119099575-119099597 CTGGACAGACAGGCCTTGCTGGG + Intronic
1015511811 6:134045114-134045136 CTGAGCTGACTGACAGTGCTTGG - Intronic
1016272390 6:142303046-142303068 CTGGAAAGCCAGACGGTGCTTGG - Intronic
1017096741 6:150811673-150811695 CAGGGCGCACAGACGGTGCCAGG + Intronic
1018810490 6:167294847-167294869 CTTTGGTGACAGACGGTGCTGGG + Intronic
1019092777 6:169553277-169553299 ATGGGCAGGGAGACGTTGCTGGG - Intronic
1019236445 6:170619512-170619534 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1019620011 7:1987306-1987328 CCTGGCACACAGTCGGTGCTTGG + Intronic
1020634330 7:10678078-10678100 CTAGGCAGACAGGAGGTGCTTGG - Intergenic
1021571122 7:22066222-22066244 CTAGGAAGACAGTCAGTGCTAGG + Intergenic
1022048514 7:26643175-26643197 CTGGACAGACAGGCCCTGCTGGG + Intronic
1023923614 7:44649022-44649044 CAGGGCAGACAGGCTGTGATGGG - Intronic
1023991846 7:45133270-45133292 CTGGGCACACAGGAGCTGCTGGG - Intergenic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1027441026 7:78219365-78219387 CTGTCCAGATAGACAGTGCTGGG - Intronic
1028888648 7:95962224-95962246 ATGGGCAGTCAGATGGAGCTGGG - Intronic
1029216972 7:98957554-98957576 CTGAGCACTGAGACGGTGCTGGG - Intronic
1029710677 7:102297707-102297729 CTGGGCATACAGCAGGCGCTTGG - Intronic
1032496749 7:132368532-132368554 CTGGGCAGACAGAGGGTGACAGG - Intronic
1033457928 7:141519140-141519162 GTGGACAGACAGACTGTGGTGGG - Intergenic
1034547591 7:151799125-151799147 CTGGGCAGTCACAGGGTGTTAGG + Intronic
1035445919 7:158943319-158943341 CCAGGCACACAGTCGGTGCTGGG - Intronic
1035511325 8:187095-187117 CTGGACAAACAGAGTGTGCTGGG - Intergenic
1035632272 8:1117168-1117190 CAGGTCAAACAGACGGTGTTGGG - Intergenic
1040631987 8:49224771-49224793 CCTGGGCGACAGACGGTGCTGGG - Intergenic
1041775322 8:61516359-61516381 CTGAGCAGACACACCTTGCTAGG + Intronic
1042336927 8:67639440-67639462 CTAGGCACACAGACTGTGCTGGG + Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1047940296 8:129822672-129822694 CTGGTCTGACAGAGGGAGCTGGG + Intergenic
1048360053 8:133689884-133689906 CTGGGAAGAAAGAATGTGCTTGG + Intergenic
1049860386 8:144894291-144894313 CTGGGCAGACAGACGGTGCTGGG - Intronic
1050367051 9:4882274-4882296 CTGGGCAGAAAGAAGCTGCCAGG - Intronic
1051467035 9:17391188-17391210 CTGAGCAGACAGGCCTTGCTTGG - Intronic
1052238712 9:26246424-26246446 CTGGCAAGAAAGACAGTGCTAGG + Intergenic
1055305873 9:74928433-74928455 CTGAACAGACAGACCTTGCTGGG - Intergenic
1057080758 9:92172838-92172860 CTGAGCAGGCAGTCGGTGCCAGG - Intergenic
1060269199 9:122129005-122129027 CTGGGCACCCAGTCGGTACTTGG + Intergenic
1060768048 9:126309647-126309669 CTGGGGAGAGGGAGGGTGCTGGG - Intergenic
1061678660 9:132231883-132231905 CTGGGCAGAGAGCAGGGGCTTGG + Intronic
1062322102 9:135995106-135995128 CTGTGGAGACAGACGGTGGAGGG - Intergenic
1062756595 9:138299524-138299546 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1185747159 X:2583011-2583033 CAGGGCAGACAGAAGCTGTTTGG - Intergenic
1186102705 X:6173619-6173641 CTAGGCAGACAGACCTGGCTGGG + Intronic
1189461916 X:41250068-41250090 CTGGGTAGACTGGCCGTGCTGGG + Intergenic
1190846148 X:54192431-54192453 CTGTGCAGACAGACAGATCTGGG + Intergenic
1192392345 X:70743520-70743542 CTGCCCAGACAGAACGTGCTTGG - Intronic
1194322063 X:92460714-92460736 CCGGGCAGAGAGACAGTGCCAGG + Intronic
1197318075 X:124992710-124992732 CTGGACAGACAGACCATGCTGGG + Intergenic
1200000467 X:153057191-153057213 CTGGGCAGATACAGGGTGATTGG + Exonic
1200375000 X:155770478-155770500 CTGGCCAGAGAGACTGTGATGGG + Intronic
1202383717 Y:24302541-24302563 CTGGACAAACAGAGTGTGCTGGG + Intergenic
1202487066 Y:25367579-25367601 CTGGACAAACAGAGTGTGCTGGG - Intergenic