ID: 1049861820

View in Genome Browser
Species Human (GRCh38)
Location 8:144903816-144903838
Sequence CTTCTCCTATAGGGCAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049861815_1049861820 5 Left 1049861815 8:144903788-144903810 CCTTCAGCTCCAAGACTAAAGGC No data
Right 1049861820 8:144903816-144903838 CTTCTCCTATAGGGCAACAAAGG No data
1049861809_1049861820 23 Left 1049861809 8:144903770-144903792 CCCCCTCTTCCTCTGGCTCCTTC No data
Right 1049861820 8:144903816-144903838 CTTCTCCTATAGGGCAACAAAGG No data
1049861811_1049861820 21 Left 1049861811 8:144903772-144903794 CCCTCTTCCTCTGGCTCCTTCAG No data
Right 1049861820 8:144903816-144903838 CTTCTCCTATAGGGCAACAAAGG No data
1049861812_1049861820 20 Left 1049861812 8:144903773-144903795 CCTCTTCCTCTGGCTCCTTCAGC No data
Right 1049861820 8:144903816-144903838 CTTCTCCTATAGGGCAACAAAGG No data
1049861816_1049861820 -4 Left 1049861816 8:144903797-144903819 CCAAGACTAAAGGCTCCAGCTTC No data
Right 1049861820 8:144903816-144903838 CTTCTCCTATAGGGCAACAAAGG No data
1049861810_1049861820 22 Left 1049861810 8:144903771-144903793 CCCCTCTTCCTCTGGCTCCTTCA No data
Right 1049861820 8:144903816-144903838 CTTCTCCTATAGGGCAACAAAGG No data
1049861813_1049861820 14 Left 1049861813 8:144903779-144903801 CCTCTGGCTCCTTCAGCTCCAAG No data
Right 1049861820 8:144903816-144903838 CTTCTCCTATAGGGCAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049861820 Original CRISPR CTTCTCCTATAGGGCAACAA AGG Intergenic
No off target data available for this crispr