ID: 1049862656

View in Genome Browser
Species Human (GRCh38)
Location 8:144910517-144910539
Sequence ATGTGAGCACAAAGGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049862648_1049862656 4 Left 1049862648 8:144910490-144910512 CCCAGGCTTTCTTACCAGTTTCC No data
Right 1049862656 8:144910517-144910539 ATGTGAGCACAAAGGAAAGAGGG No data
1049862649_1049862656 3 Left 1049862649 8:144910491-144910513 CCAGGCTTTCTTACCAGTTTCCC No data
Right 1049862656 8:144910517-144910539 ATGTGAGCACAAAGGAAAGAGGG No data
1049862650_1049862656 -10 Left 1049862650 8:144910504-144910526 CCAGTTTCCCCAGATGTGAGCAC No data
Right 1049862656 8:144910517-144910539 ATGTGAGCACAAAGGAAAGAGGG No data
1049862645_1049862656 25 Left 1049862645 8:144910469-144910491 CCAGTGTCACCAGAGGGAGCACC No data
Right 1049862656 8:144910517-144910539 ATGTGAGCACAAAGGAAAGAGGG No data
1049862647_1049862656 16 Left 1049862647 8:144910478-144910500 CCAGAGGGAGCACCCAGGCTTTC No data
Right 1049862656 8:144910517-144910539 ATGTGAGCACAAAGGAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049862656 Original CRISPR ATGTGAGCACAAAGGAAAGA GGG Intergenic
No off target data available for this crispr