ID: 1049862727

View in Genome Browser
Species Human (GRCh38)
Location 8:144911086-144911108
Sequence GAGGAGTCCCTGGGCACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049862715_1049862727 11 Left 1049862715 8:144911052-144911074 CCACCCTTACAACCTCACATGCC No data
Right 1049862727 8:144911086-144911108 GAGGAGTCCCTGGGCACACAGGG No data
1049862713_1049862727 25 Left 1049862713 8:144911038-144911060 CCACTCAGTGAAACCCACCCTTA No data
Right 1049862727 8:144911086-144911108 GAGGAGTCCCTGGGCACACAGGG No data
1049862717_1049862727 7 Left 1049862717 8:144911056-144911078 CCTTACAACCTCACATGCCCTCC No data
Right 1049862727 8:144911086-144911108 GAGGAGTCCCTGGGCACACAGGG No data
1049862721_1049862727 -10 Left 1049862721 8:144911073-144911095 CCCTCCTCTTCTGGAGGAGTCCC No data
Right 1049862727 8:144911086-144911108 GAGGAGTCCCTGGGCACACAGGG No data
1049862716_1049862727 8 Left 1049862716 8:144911055-144911077 CCCTTACAACCTCACATGCCCTC No data
Right 1049862727 8:144911086-144911108 GAGGAGTCCCTGGGCACACAGGG No data
1049862718_1049862727 -1 Left 1049862718 8:144911064-144911086 CCTCACATGCCCTCCTCTTCTGG No data
Right 1049862727 8:144911086-144911108 GAGGAGTCCCTGGGCACACAGGG No data
1049862714_1049862727 12 Left 1049862714 8:144911051-144911073 CCCACCCTTACAACCTCACATGC No data
Right 1049862727 8:144911086-144911108 GAGGAGTCCCTGGGCACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049862727 Original CRISPR GAGGAGTCCCTGGGCACACA GGG Intergenic
No off target data available for this crispr