ID: 1049865350

View in Genome Browser
Species Human (GRCh38)
Location 8:144932084-144932106
Sequence TCAAATAGTCCACACTGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049865350_1049865355 -6 Left 1049865350 8:144932084-144932106 CCTCCCCAGTGTGGACTATTTGA 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1049865355 8:144932101-144932123 ATTTGACGCTGAATAAGGTCAGG 0: 1
1: 0
2: 1
3: 1
4: 70
1049865350_1049865356 4 Left 1049865350 8:144932084-144932106 CCTCCCCAGTGTGGACTATTTGA 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1049865356 8:144932111-144932133 GAATAAGGTCAGGATTTCCTTGG 0: 1
1: 0
2: 2
3: 18
4: 159
1049865350_1049865357 8 Left 1049865350 8:144932084-144932106 CCTCCCCAGTGTGGACTATTTGA 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1049865357 8:144932115-144932137 AAGGTCAGGATTTCCTTGGAAGG 0: 1
1: 1
2: 2
3: 32
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049865350 Original CRISPR TCAAATAGTCCACACTGGGG AGG (reversed) Exonic
902661290 1:17905809-17905831 TGAATGAGTCCACATTGGGGTGG + Intergenic
921236217 1:213133916-213133938 TCAAATATTCTACAATGGAGAGG - Intronic
922462422 1:225823811-225823833 CCAAGAAGTCCACCCTGGGGAGG + Intronic
1065402960 10:25327481-25327503 TTAAATGGTGCACACTGGGCTGG + Intronic
1074111886 10:110428680-110428702 TCAAAGAGTCCACACAGGTGAGG - Intergenic
1076288916 10:129328988-129329010 AAAAATAGCCCACACTGCGGAGG + Intergenic
1088326803 11:108609139-108609161 GCCAATTGTCCCCACTGGGGTGG - Intergenic
1089662208 11:119992996-119993018 CCAAAGAGCCCACACAGGGGAGG + Intergenic
1098628427 12:72700527-72700549 CCAAAAAGTCCAGACTGAGGTGG - Intergenic
1100899192 12:99219015-99219037 ACAAATAATCCACAATGTGGAGG + Intronic
1101121190 12:101581997-101582019 TCAAATAGTCCCCTGTGAGGAGG + Intronic
1106513232 13:30429557-30429579 TCAAAAAGTCCTTACTGGAGAGG - Intergenic
1110257375 13:73446346-73446368 TCAACTAATCCAAACTGGAGGGG + Intergenic
1111313853 13:86525825-86525847 TCAAATACACCAAACTGGTGAGG + Intergenic
1113817708 13:113186129-113186151 ACAAAAAGTACACACTGTGGTGG + Intronic
1116109366 14:40557085-40557107 TTAAATATTTCACACTGGGCTGG - Intergenic
1118866564 14:69708915-69708937 TCACATAGTCCAGACTGGCCTGG - Exonic
1120275726 14:82370420-82370442 TCAACTTGGCCACAGTGGGGTGG + Intergenic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1128962273 15:72019502-72019524 GCAAATAGTTTAAACTGGGGAGG + Intronic
1129501262 15:76039811-76039833 TCAAATGGTCCACCTTTGGGAGG - Intronic
1130625800 15:85513099-85513121 AAAAATAGTCAACACTGGGCCGG - Intronic
1146412451 17:32598444-32598466 TCAAAAATTCCACCATGGGGTGG - Intronic
1148929717 17:51118742-51118764 TGAAATAGTCCATTCTGGCGGGG + Intronic
1157493156 18:48137810-48137832 TCCGGCAGTCCACACTGGGGTGG + Intronic
1159668895 18:71198815-71198837 TGAAATGGCCCACACTGGGCTGG + Intergenic
1162280186 19:9690176-9690198 TGAAAGAATTCACACTGGGGAGG - Exonic
1162439330 19:10682898-10682920 TCCTATAGGCTACACTGGGGTGG + Intronic
1165883109 19:39057368-39057390 TCAGTGAGTCCCCACTGGGGTGG - Intergenic
1168681502 19:58319171-58319193 ACAAGGAGTCCACGCTGGGGAGG + Intergenic
925198175 2:1944626-1944648 CCAAATAGTACACACTGGTCAGG - Intronic
927149911 2:20189602-20189624 ACAGATACTGCACACTGGGGTGG + Intergenic
932492602 2:72131656-72131678 TCAAATTGTCCAAACTGGTGAGG + Exonic
934537637 2:95148983-95149005 TCAGACAGCCGACACTGGGGAGG - Exonic
935051314 2:99527349-99527371 ACAAATGGACCACTCTGGGGAGG + Intergenic
936790231 2:116142602-116142624 TGAAATTTTCCACACTGTGGTGG + Intergenic
942847532 2:180444382-180444404 TCTCTTAGTCAACACTGGGGAGG + Intergenic
1168844672 20:935729-935751 TAAAAAATTCCACATTGGGGCGG + Intergenic
1170172307 20:13428975-13428997 TCAAATAGTTCACAATCTGGTGG + Intronic
1171279751 20:23885955-23885977 CCAAAATGTCCACAGTGGGGAGG + Intergenic
1174483993 20:50850062-50850084 TCAAATCCTCCACAGTGGAGGGG - Intronic
1175628011 20:60505262-60505284 GCAAAATTTCCACACTGGGGAGG - Intergenic
1177361636 21:20079982-20080004 TCAAATACTCTACACTGAGTGGG - Intergenic
1179978303 21:44883279-44883301 TCAAATTGTCGACACTGGCTGGG - Intergenic
1180044348 21:45296936-45296958 TTAAATAGTCCAGACAGAGGCGG + Intergenic
949289849 3:2451422-2451444 TAAAATAGTTTAGACTGGGGAGG + Intronic
950497706 3:13343886-13343908 GCACATAGCTCACACTGGGGTGG - Intronic
951799572 3:26580640-26580662 CCAAATAGTCCCCAGTGGGATGG + Intergenic
969426936 4:7129993-7130015 TCATTTACTCCACACTGGCGGGG - Intergenic
970108666 4:12613378-12613400 AGAAATAGTCTACATTGGGGAGG + Intergenic
970897944 4:21125069-21125091 GCAAAGAGTTCAGACTGGGGAGG - Intronic
971943580 4:33245824-33245846 ACAGAGAGTCCCCACTGGGGTGG - Intergenic
976998018 4:91460689-91460711 TCGAAGAGTAAACACTGGGGTGG - Intronic
977290447 4:95159917-95159939 TCAAATACTCCACAGCTGGGAGG - Intergenic
983215998 4:165003145-165003167 TTAAAAAGTTCACACTGGGCAGG + Intergenic
989023749 5:37042138-37042160 TCAAAAAGTCCAAAATGGGCTGG + Intronic
993532455 5:89041271-89041293 TAAAACAGTCCTCACTGGGGAGG + Intergenic
996897548 5:128503500-128503522 TCAAAAAGTCCAGGCTGAGGTGG + Intronic
999987664 5:157020182-157020204 ACAAATATGCCACACTGGTGGGG + Intergenic
1001329667 5:170753362-170753384 AAAAATAGTCCACCCTGGGGAGG - Intergenic
1006922631 6:37636663-37636685 TCAAAGGGTGCACACTGAGGAGG + Exonic
1010250243 6:73699664-73699686 TCAAGTACTCAAGACTGGGGCGG + Intronic
1014425882 6:121305521-121305543 TTAAATAGTCTAATCTGGGGGGG + Intronic
1022211047 7:28209721-28209743 ACAAATACCCCAGACTGGGGGGG - Intergenic
1022964679 7:35461678-35461700 TCCAAAACTCCACGCTGGGGAGG - Intergenic
1029357684 7:100064581-100064603 TCAGCGAGTCCACACTGGAGAGG + Exonic
1029955217 7:104631600-104631622 TAAAATAGTCTCCACTGGTGGGG + Intronic
1030344319 7:108415406-108415428 TCAAATGGTGCAAACTTGGGAGG + Intronic
1032144655 7:129368147-129368169 GCAGAAAGTCCCCACTGGGGAGG + Intronic
1033340663 7:140489757-140489779 TAAAATATTCCACACTGGCTTGG - Intergenic
1034719265 7:153273731-153273753 TCAAATAGTCCTCACTTAAGAGG - Intergenic
1039023342 8:33231220-33231242 TCATAGATTTCACACTGGGGAGG - Intergenic
1042677116 8:71333456-71333478 TGAAATATTCCAAACTGGGCTGG + Intronic
1044636246 8:94327547-94327569 TCAAATAGTCCACCAGGTGGTGG - Intergenic
1046054747 8:109065930-109065952 ACAAATGTTCCACTCTGGGGAGG - Intergenic
1047863855 8:128999924-128999946 TCATAAAGTCCACTTTGGGGAGG + Intergenic
1048027638 8:130601369-130601391 TCAAAGAGACCACACCAGGGAGG + Intergenic
1049555986 8:143282439-143282461 TCAGATAATCCCCACTGGAGAGG + Intergenic
1049865350 8:144932084-144932106 TCAAATAGTCCACACTGGGGAGG - Exonic
1057971392 9:99561620-99561642 TGAAATCATCCACCCTGGGGAGG - Intergenic
1058532887 9:105924538-105924560 TCAACTAGTCCATATTTGGGTGG + Intergenic
1060355819 9:122905865-122905887 ACAAAGAGTCCAAAGTGGGGGGG + Intergenic
1187626971 X:21125789-21125811 TAAAATACTCTACACTGAGGTGG - Intergenic
1189615179 X:42775947-42775969 TCAGCCAGTCCACACTGGGTGGG - Intergenic
1191680393 X:63834172-63834194 TCAAGAAGACCACACTGGGAAGG - Intergenic
1197861526 X:130976083-130976105 CCTAAATGTCCACACTGGGGCGG + Intergenic