ID: 1049867499

View in Genome Browser
Species Human (GRCh38)
Location 8:144948304-144948326
Sequence CAGGGTGCTCAGAGGAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 299}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049867493_1049867499 28 Left 1049867493 8:144948253-144948275 CCACATTTCTGTGTCAGGAGAGA 0: 1
1: 0
2: 0
3: 22
4: 239
Right 1049867499 8:144948304-144948326 CAGGGTGCTCAGAGGAATGGTGG 0: 1
1: 0
2: 1
3: 33
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049867499 Original CRISPR CAGGGTGCTCAGAGGAATGG TGG Intronic
901468047 1:9435884-9435906 CAGGGTGCTTTGAGGAATCATGG - Intergenic
902408272 1:16198434-16198456 CAGGCTGGACACAGGAATGGGGG - Exonic
903555929 1:24193374-24193396 TTGGTTCCTCAGAGGAATGGAGG + Intergenic
904030815 1:27532422-27532444 CTGAGGGCTCAGAGGAGTGGCGG - Intergenic
905282677 1:36859290-36859312 CAGGGTGGGCTGAGGACTGGAGG - Intronic
905312007 1:37055847-37055869 CAGGGTGCTCAGAGCACAGTAGG - Intergenic
906169605 1:43713333-43713355 CAGGTTGCTCTGAGGATTGGAGG + Intronic
906543454 1:46605355-46605377 GGGGGTGCTCAGAGGAAGGAGGG + Intronic
906776708 1:48536313-48536335 CAGGGTGCTCACAGGGGTGGAGG + Intronic
907334261 1:53690078-53690100 CAGGGTGCTCACAGCAGAGGGGG - Intronic
909329272 1:74393084-74393106 CAGTGTGCTGAGAGGAGTGAAGG + Intronic
909329964 1:74398735-74398757 GAGGGTGCTAAGAGGAATTATGG + Intronic
909958349 1:81803440-81803462 CAGAGTGAACAGAGGATTGGAGG - Intronic
910257100 1:85259291-85259313 CAGGGGGCTCAGGAGAAAGGGGG + Intronic
912690566 1:111801654-111801676 CAGAGTGCTCTGAAGAGTGGGGG - Intronic
913087472 1:115452104-115452126 CAGAGTGCTCACAGAAGTGGAGG - Intergenic
913568767 1:120099691-120099713 CAGAGTGCTGGCAGGAATGGTGG - Intergenic
914289582 1:146260712-146260734 CAGAGTGCTGGCAGGAATGGTGG - Intergenic
914550618 1:148711465-148711487 CAGAGTGCTGGCAGGAATGGTGG - Intergenic
914827776 1:151147531-151147553 CACGGTCCTCTGAGGAAAGGTGG - Intergenic
915042469 1:152980694-152980716 CAAGGTGATCAGAGAAAGGGAGG + Intergenic
915164387 1:153940556-153940578 CAGCGGGCACAGAGGAATGTAGG + Exonic
915466355 1:156100585-156100607 CAGGGAGCTCAGATGAAGGGAGG + Intronic
918112074 1:181464839-181464861 CAGGATGGTCAGAGGTAAGGTGG - Intronic
919809305 1:201399032-201399054 CAGGGTGCTTAGGGGAAGGCTGG - Intronic
920224154 1:204425797-204425819 GAGTGTGATCACAGGAATGGTGG - Intronic
921101477 1:211932694-211932716 AAGGGTGCACAGAGAAGTGGTGG - Intergenic
921325684 1:213984707-213984729 CAGGGTGCTGATAGTGATGGTGG + Intronic
922614690 1:226954902-226954924 CAGGGTGCTGGGAGGCATGTTGG + Intronic
923241190 1:232087246-232087268 GAGGGTATTCAGAGGAAAGGAGG + Intergenic
923511541 1:234657850-234657872 CAGGGTGATCTGAGACATGGTGG + Intergenic
923838107 1:237637057-237637079 CAGGGAGCTCTGAGGAGTGACGG + Intronic
923997533 1:239512282-239512304 GAGAGTGGTCAGAGAAATGGGGG + Intronic
924384101 1:243487143-243487165 GCAGGTGCTCAGATGAATGGTGG + Intronic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1067187900 10:44045520-44045542 CAGGATGCTGGGAGGGATGGAGG + Intergenic
1067859298 10:49828448-49828470 CAAGGTGCTCAGAAAAATGCAGG + Intronic
1070395217 10:76006271-76006293 GAGGGTGTTCAGAGGAGTGAGGG + Intronic
1070776668 10:79113776-79113798 GAGGGGGCTCAGAGGAAAGGGGG - Intronic
1070799778 10:79238402-79238424 CAGGAGGCTAAGAGGCATGGAGG + Intronic
1072292177 10:93974298-93974320 CAGGGAGCTCAGAAGAAGGTGGG + Intergenic
1075438044 10:122459776-122459798 CTGGCTGCTCAGGGGGATGGAGG + Intergenic
1075512908 10:123086760-123086782 CTGGGAGCTCAGAGGAGTGAGGG + Intergenic
1075611854 10:123861051-123861073 CAGGGAGCTCATGGGATTGGGGG - Intronic
1075725028 10:124606692-124606714 CAGGGTGCTCAGCTGTCTGGGGG + Intronic
1076713184 10:132350350-132350372 CAGGGTCCTGAGGGGTATGGAGG - Intronic
1077334112 11:1995827-1995849 CAGGGTGCTCGGGGGCCTGGAGG + Intergenic
1077573719 11:3360992-3361014 CGGAGTGCTGAGAGAAATGGTGG + Intronic
1079082173 11:17421232-17421254 CAAGGAGCTCAGAGTCATGGAGG + Intronic
1080401633 11:31941730-31941752 CAGTGTGCTCTGAGGAATAGGGG + Intronic
1081236547 11:40654020-40654042 GAGGGTGCACAGAAGAATTGAGG + Intronic
1081484211 11:43515493-43515515 CTGGGTGCTCAGAGGCATTGGGG - Intergenic
1082163365 11:48909361-48909383 CAAGGTGCTCAGAACAATGCTGG + Intergenic
1083059259 11:59852463-59852485 CATGTTGCTCAGAAGAAAGGGGG - Intergenic
1083776902 11:64898446-64898468 CAGCGTGTTCAGAGGCAGGGTGG - Intronic
1083885586 11:65572124-65572146 CAGGATGCTCAGGGGAAGGAGGG - Intronic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084653753 11:70503504-70503526 CAGGGTGCTTACAAGAGTGGGGG + Intronic
1084715729 11:70872375-70872397 CGGGGTGCACAGTGGAAAGGAGG + Intronic
1085526085 11:77165151-77165173 CAGGGGACACACAGGAATGGAGG - Intronic
1085862858 11:80255148-80255170 CAGGTTGATCAGAGGAAAGGTGG + Intergenic
1086879568 11:92137623-92137645 CAGGGAGTTCAGGGGAATTGGGG + Intergenic
1087963945 11:104389362-104389384 CAGGGTGAACAGAGCAATAGAGG + Intergenic
1088319168 11:108537011-108537033 CAGGGTGCTCGTAGGTAAGGAGG + Intronic
1088586875 11:111367182-111367204 CAGGAGGCTCAGAGGAAGGGAGG - Intronic
1089534184 11:119150383-119150405 CATGGTGCTCACAGGTGTGGGGG - Intronic
1089954311 11:122556146-122556168 GAGGGTGGCCAGAGGCATGGGGG - Intergenic
1090024968 11:123159674-123159696 CAGGGGGCACACAGGAAGGGTGG + Intronic
1090493074 11:127182940-127182962 CAGAGTGATCACAGGAGTGGAGG + Intergenic
1090857580 11:130623722-130623744 CTGGATGCTCAGTGGAGTGGAGG + Intergenic
1091162652 11:133439124-133439146 CAGGTTGGTCAGAAGTATGGTGG + Intronic
1202817095 11_KI270721v1_random:51009-51031 CAGGGTGCTCGGGGGCCTGGAGG + Intergenic
1091591315 12:1844444-1844466 CAGGATGCTCTGAGGCCTGGCGG + Exonic
1091647065 12:2281880-2281902 TAGAGTTCTCACAGGAATGGGGG - Intronic
1091820155 12:3470271-3470293 CTGGATGCCCAGAGGACTGGAGG - Intronic
1091874490 12:3922505-3922527 CTGGGTGCTGTGAGGAATAGAGG - Intergenic
1094474818 12:30833052-30833074 CAGGGTGCACAGAGGAGGTGGGG - Intergenic
1095595229 12:43951041-43951063 CATGGAGCCCAGAGGAGTGGGGG + Intronic
1095665106 12:44788567-44788589 GAGGGTGCCCAGAGGCATGGGGG + Intronic
1096184264 12:49568002-49568024 GAGGGTTCTCAGAGGAGTTGGGG - Intronic
1098041978 12:66361824-66361846 CATGGTCCTGAGAGGAACGGAGG - Intronic
1098307624 12:69117440-69117462 CAGAGGGCTCAGAGGAAGGCAGG - Intergenic
1100679644 12:96905662-96905684 CAGTGAGGACAGAGGAATGGAGG + Intergenic
1101241345 12:102842769-102842791 CTGAGAGGTCAGAGGAATGGAGG - Intronic
1102180155 12:110906570-110906592 AATGCTGCTCAGAGAAATGGGGG - Intronic
1102513242 12:113429480-113429502 CAGGGTGGGCAGAGGAAAGTTGG - Intronic
1102609068 12:114095349-114095371 CAGGTTTCTCAGAGGAAGGTGGG + Intergenic
1103795429 12:123499844-123499866 CTGAGTGGTCAGAGGAAGGGAGG - Intronic
1103944714 12:124519590-124519612 CAGGGAGCTAATAGGAGTGGAGG + Intronic
1105277875 13:18946839-18946861 CATGGTGCCCAGAAGAATGGGGG - Intergenic
1105416267 13:20214509-20214531 CAGGGGGCTCTGAGGCATAGGGG + Intergenic
1105543350 13:21333872-21333894 CAGGGTGTTAACAGGGATGGGGG - Intergenic
1105634943 13:22207972-22207994 TGGGGTGATCAGAGGAATAGTGG - Intergenic
1105701776 13:22939978-22940000 CAGGGTCCCCAGAGGAAGGCGGG + Intergenic
1105854399 13:24361766-24361788 CAGGGTGCCCAGAGGAAGGCGGG + Intergenic
1105890768 13:24680881-24680903 GGGGGCGCTCAGAGGAAAGGCGG - Intronic
1106455706 13:29924821-29924843 CAGGGTGCTCAGGGCAAAAGAGG + Intergenic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1108268372 13:48734369-48734391 CAGGGTACTGATAGGAATGGTGG + Intergenic
1111027289 13:82546068-82546090 CAAGGTCCTAAGAGGAAGGGAGG + Intergenic
1111224272 13:85249036-85249058 CAGAGAGATCAGAGGAAAGGAGG + Intergenic
1112349758 13:98623006-98623028 CAGGCGGCCCAGAGGAATGGAGG + Intergenic
1112972590 13:105279011-105279033 CAGTTTGCTCAGAGGATTAGAGG - Intergenic
1113938082 13:114005703-114005725 CTGGGTGCTCTGGGGACTGGGGG + Intronic
1114653725 14:24303324-24303346 CAAGGAGTTCACAGGAATGGGGG + Intronic
1114731787 14:25000736-25000758 CAGGGTTCTCTCTGGAATGGGGG - Intronic
1116233155 14:42243669-42243691 CAGACTGCTTTGAGGAATGGAGG - Intergenic
1117210763 14:53496496-53496518 CAGGTTTGACAGAGGAATGGAGG - Intergenic
1117302994 14:54446650-54446672 TAGGATGCTCAGAGACATGGTGG + Intergenic
1117823422 14:59675137-59675159 TATGGTGCACAGAGGAGTGGTGG + Intronic
1118745358 14:68769267-68769289 CAGGCTCCTCAGAGCCATGGAGG + Intergenic
1119942506 14:78656406-78656428 CAGGGTGAGCAAAGGCATGGAGG + Intronic
1122129232 14:99595595-99595617 CTGGGAGCTCAGAGGAGGGGTGG - Intronic
1122767740 14:104083402-104083424 CATGGTGCTCACAGGGATGCAGG + Intergenic
1122843167 14:104476605-104476627 CAGGGTGCCCAGAGGAAGGTGGG + Intronic
1122919846 14:104875489-104875511 CAGGGTGCTGTGTGGAGTGGAGG + Intronic
1123015643 14:105373369-105373391 CATGGAGATCAGTGGAATGGAGG + Intronic
1125585039 15:40813917-40813939 CAGGGATCAGAGAGGAATGGAGG - Intronic
1125884857 15:43220978-43221000 CAGGGTGCTCACAGGAGTAGTGG - Exonic
1126692424 15:51297952-51297974 TAGGCTACTCTGAGGAATGGGGG + Intronic
1126957272 15:53947555-53947577 CAAGGTGATCAGAGGCATGATGG - Intergenic
1127865732 15:63031079-63031101 CAGTGTGCTCAGAGGAATTCAGG + Intergenic
1128232082 15:66042504-66042526 CAGGGAGCTCAGAGCACTGGGGG + Intronic
1129268956 15:74409584-74409606 AAGGGGGCTGAGAGGAAGGGAGG + Exonic
1129532314 15:76278299-76278321 CAGTGGGGTCAGAGGAATGTTGG - Intronic
1130751206 15:86715024-86715046 CAGGGAGTACAGAGGCATGGTGG - Intronic
1132340955 15:101078462-101078484 CAGGGTGCAGAGAGGAAGGAAGG - Intergenic
1132728152 16:1347687-1347709 CAGGGTCCTCTGCGGAAAGGCGG - Exonic
1132764748 16:1528737-1528759 CAGGCCGCTCTGAGGACTGGAGG + Intronic
1132908927 16:2298630-2298652 CAGGGTCCTCAGAGGAAATTAGG - Intronic
1135353335 16:21749017-21749039 CAAGGTGCTCATGGGAATAGTGG + Intronic
1135451822 16:22565140-22565162 CAAGGTGCTCATGGGAATAGTGG + Intergenic
1137718840 16:50615468-50615490 CATGCTGCTCAGAGGAAGGGAGG + Intronic
1138353646 16:56360722-56360744 CCGGGTGCTCTGGTGAATGGTGG - Intergenic
1138832754 16:60395031-60395053 CAGGGTGGGCAGAGAGATGGTGG - Intergenic
1140335448 16:74100623-74100645 CAGGGTGCTAACAAGAATAGAGG + Intergenic
1140751238 16:78025946-78025968 CAGGAAGCTGAGAGGGATGGGGG + Intronic
1141120855 16:81355063-81355085 CAGGATGCTGAGAGCAAGGGTGG - Intronic
1141938930 16:87261434-87261456 CATGGTGCTCACAGGAGAGGAGG + Intronic
1142392532 16:89811606-89811628 CTGGTTGCTCAGGAGAATGGTGG - Intronic
1142471595 17:166143-166165 CAGGGTGCTCAGGGAACTGCCGG - Intronic
1142521909 17:510807-510829 GAGGGTGCTGAGGGGAGTGGAGG - Exonic
1144046208 17:11456859-11456881 CAGGGTACACAGTGGAATTGTGG - Intronic
1145102061 17:20085774-20085796 CACGGTGCTCTGAGCAATGGCGG + Intronic
1147833265 17:43312117-43312139 CAGGATGCTCTGTGGAATGGGGG - Intergenic
1148104622 17:45112725-45112747 CAGGGTGCACAGAGGACCTGAGG - Intronic
1148745483 17:49915817-49915839 CAGGATGGACAGAGGAATGCTGG - Intergenic
1149850032 17:60028681-60028703 CAGGGTGCTCAGGGGCCTGCCGG + Intergenic
1149860135 17:60117843-60117865 CAGGGTGCTCAGGGGCCTGCCGG - Intergenic
1150083605 17:62262481-62262503 CAGGGGGCTCAGAGGGCTGCTGG + Intergenic
1150431342 17:65120224-65120246 CAGGGTGGTCAGTGGGATGGAGG + Intergenic
1150433879 17:65139394-65139416 CAGGCTGCTCAGGGGAAGGTTGG - Intronic
1151491430 17:74434002-74434024 CAGGGGGCGCAGAGGCCTGGTGG - Intronic
1151570373 17:74922829-74922851 GAGGCAGCTCAGAGGAGTGGTGG + Intronic
1152199117 17:78934982-78935004 CTGGGGGCTGAGAGGAAGGGTGG - Intergenic
1152700100 17:81814409-81814431 CAGGAGGCTCAGAGGAAGGGCGG - Intergenic
1156442699 18:37207598-37207620 CAGAATGCTCAGAGGTATGAGGG + Intronic
1158465833 18:57689198-57689220 CTGGGTGCTATGGGGAATGGGGG - Intronic
1159546002 18:69839774-69839796 CTGGAAGCTCAGAGGACTGGCGG + Intronic
1161766505 19:6211665-6211687 CAGGGGGTTGAGAGGACTGGAGG + Intergenic
1164446744 19:28324194-28324216 CTGGTTGCTGTGAGGAATGGAGG - Intergenic
1164681005 19:30133745-30133767 CAGGGTGCAGAGAGGTATGCTGG + Intergenic
1164905191 19:31961378-31961400 CATGGTGCACAGAAGAAGGGAGG - Intergenic
1165079449 19:33299159-33299181 CAGGGTGCTCATTGGAGTTGGGG + Intergenic
1165081025 19:33306016-33306038 CGGGGTTCTCAGAGGACAGGGGG + Intergenic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165815540 19:38639886-38639908 CAGGGCCCTCTGAGGAATGCTGG - Intergenic
1166231651 19:41428292-41428314 CCGGGTGCCGAGAGGGATGGAGG - Intronic
1166688445 19:44809439-44809461 CAGGGTGCTGAGTGGGAAGGGGG - Intronic
1168267424 19:55230423-55230445 CAGGGTGATGAGGGCAATGGGGG + Exonic
925275360 2:2644824-2644846 CAGGGTGCTCAGAGGTGGAGGGG - Intergenic
925663883 2:6232306-6232328 CAGAGAGCACAGAGGAAAGGAGG - Intergenic
928600648 2:32900766-32900788 CAGGGTGAGCCGAGGCATGGAGG + Intergenic
929544986 2:42849840-42849862 CAGGGTGCACAGTGGAAGGGAGG - Intergenic
929598809 2:43192338-43192360 CAGGGGACTCTGAGGACTGGAGG - Intergenic
931167265 2:59761526-59761548 CAGGGTGATCAGAGGATTCCTGG + Intergenic
932216608 2:69970187-69970209 CAGGGTGTGAAGAGGCATGGAGG - Intergenic
932430823 2:71672714-71672736 CAAGCTGGCCAGAGGAATGGAGG + Intronic
933249784 2:80016355-80016377 CAGGCTGCTCAGAAGGAAGGAGG + Intronic
935044347 2:99466733-99466755 CAAGGTGCTCCGAGAAAAGGTGG + Intronic
935554936 2:104499166-104499188 CTGGGTGGTCAGAGGAGTGCAGG + Intergenic
936985492 2:118308539-118308561 GAAGGTTCACAGAGGAATGGAGG + Intergenic
937701011 2:124863019-124863041 CTAGGTCCTAAGAGGAATGGTGG + Intronic
938064305 2:128272832-128272854 CGGGGCCCTCAGAGGACTGGAGG + Intronic
938104638 2:128521503-128521525 TGGGGTGCTCATAAGAATGGGGG + Intergenic
938579782 2:132635598-132635620 CAGCGTGTGCAGAGGCATGGAGG + Intronic
939953991 2:148509656-148509678 CTGTGTGATCAGAGGAAGGGCGG - Intronic
940430529 2:153584532-153584554 CAGGGTGGTATGGGGAATGGTGG - Intergenic
940709461 2:157144400-157144422 GAGGGTGGTCAGAGGAGCGGGGG - Intergenic
940904938 2:159160715-159160737 CAGGGTTCTCAGAGGCAGGGAGG - Intronic
943220959 2:185105339-185105361 CAGGCTGCTGGGAGGAAGGGGGG - Intergenic
944383381 2:199137749-199137771 CAGAGAGCTCAGAGGAATATGGG - Intergenic
945853163 2:215034407-215034429 CAGAGTGTGGAGAGGAATGGGGG + Intronic
945984931 2:216345919-216345941 CAGGCTGCTCAGAGATAAGGAGG - Intronic
946835092 2:223764415-223764437 CAGTGTCCTGGGAGGAATGGAGG + Intronic
947488735 2:230575790-230575812 CAGGGAGCCCAGATGAATGCTGG - Intergenic
948431786 2:237923379-237923401 CAGGGGGCTGGGAGGAAAGGAGG - Intergenic
948585165 2:239014801-239014823 CAGGCTGCTAAGGGGGATGGGGG - Intergenic
1169566223 20:6856389-6856411 CAAGGTCCTCAGAGGGAAGGTGG - Intergenic
1171500314 20:25587786-25587808 AGGGGTGCTCAGAGCCATGGGGG + Intergenic
1172900383 20:38330446-38330468 CAGTGATCTCAGAGGAAGGGGGG - Intronic
1174132272 20:48354131-48354153 GTGGGTGCTCAGAGAGATGGTGG + Intergenic
1175832710 20:61975621-61975643 CAGGATTCTCAGCGGAGTGGAGG + Exonic
1175887468 20:62300607-62300629 CAGCATGCTCATAGGAATGTGGG + Intergenic
1176305029 21:5118795-5118817 CAAGGTGCTCAGAGGCGTCGAGG - Exonic
1179788389 21:43741994-43742016 CAGTGTGGTCACAGGAGTGGGGG - Intronic
1179852026 21:44143235-44143257 CAAGGTGCTCAGAGGCGTCGAGG + Exonic
1180319530 22:11307704-11307726 CAGGGTGCAGAGAGGGGTGGTGG + Intergenic
1181260504 22:21593807-21593829 CAGGCTGGTCACAGGACTGGGGG - Intronic
1181930375 22:26396086-26396108 CAGGGTGCTCAGAACAAAGCAGG + Intergenic
1182057674 22:27372650-27372672 CAGGGTCCTCAGAGTGAAGGTGG + Intergenic
1182239434 22:28903312-28903334 CTGGTTGCTCCGAGGAAAGGAGG + Intronic
1182357364 22:29728333-29728355 CAGGGTGCTGGGAGCAACGGAGG + Intronic
1182485615 22:30636872-30636894 CAGGGTGAACAGAGGTGTGGTGG - Exonic
1183589205 22:38770111-38770133 CAGGGAGCCCAGAGGAGTGGAGG - Intronic
1183733785 22:39632382-39632404 CAGGGGGCTCTGAGGAGTGTGGG - Intronic
1184089704 22:42285881-42285903 CAGGCTTCTCAGAGGAAGTGAGG - Intronic
1184290994 22:43498168-43498190 CAGGGTGGTCAGAGGGAATGCGG - Intronic
1184795344 22:46728874-46728896 AGGGGTGCTCAGAGGAGAGGGGG + Intronic
1184858710 22:47161006-47161028 CAGGGTGCTGGGAAGAAGGGGGG + Intronic
1185021520 22:48379496-48379518 CAGGGTGCCCACAGTAATGCTGG + Intergenic
1185216205 22:49601258-49601280 CAGGGGGCTCAGGGGTCTGGGGG + Intronic
949734622 3:7157737-7157759 CAGGGTGCTTGGAGGAATTTGGG - Intronic
949918923 3:8986247-8986269 CTGGGGGCTCAGAGGGATGAGGG - Intronic
949986415 3:9544783-9544805 CAGGATGATCACAGGCATGGAGG - Intronic
950399264 3:12758439-12758461 CAGGGTGCTCTGAGCAGAGGTGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
950849771 3:16051347-16051369 GAGGGTGCTGAGAGGGGTGGGGG + Intergenic
951778168 3:26333581-26333603 CAAGGTACTCAGAGAAATGCTGG - Intergenic
952500770 3:33959758-33959780 CAGTGAGCTCAGAGGGATTGCGG + Intergenic
952953641 3:38543464-38543486 AAGTGTGCTTAGAGCAATGGTGG + Intergenic
954142921 3:48619618-48619640 CAGGGTCCTTAGAGCAAGGGCGG + Intergenic
956019666 3:64920775-64920797 CAGGGTACTCACAGGCATGTGGG + Intergenic
956508637 3:69970968-69970990 CAAGTTGCTTTGAGGAATGGGGG + Intergenic
957908809 3:86593986-86594008 CAGGTTGCTAATAGGAGTGGAGG - Intergenic
959121031 3:102232330-102232352 CTGGGTGCCCAGTAGAATGGTGG + Intronic
960092972 3:113660515-113660537 AAGAGTGCTTATAGGAATGGTGG + Exonic
961186333 3:124918331-124918353 CTGTGAGCTCAGAGGCATGGAGG - Intronic
961210352 3:125120616-125120638 CAGGGAGCCCAGGGGAATGCTGG + Exonic
962006355 3:131353794-131353816 CAGTGGGCTCAGAGTAAAGGAGG + Intergenic
962359489 3:134725870-134725892 CAGGGGGCTCAGAGGAGCGAGGG + Intronic
963183202 3:142382538-142382560 GGAGGTGCTCAGAAGAATGGTGG - Intronic
964464960 3:156981709-156981731 CAGGTTGCTCAGAGGTCAGGAGG + Intronic
966863275 3:184242243-184242265 CAGGGAGCTCAGAGGATGGAGGG - Exonic
967007752 3:185400243-185400265 CAGGGTGCGCAGACGCAGGGAGG - Intronic
967257592 3:187609416-187609438 GAGGGTGGCCAGAGGCATGGGGG - Intergenic
968387880 4:160125-160147 CAGGGTGCTGAAAGAAATGGTGG - Intronic
969451830 4:7278252-7278274 CAGGCTGCTCAGAGGAGAGAGGG - Intronic
970439930 4:16071891-16071913 CAGGGTGATCAGAGGAAGTTAGG - Intronic
971395341 4:26221932-26221954 CAGGGCGGTGAGAGGGATGGGGG + Intronic
971551234 4:27958766-27958788 CAGGGTAATCAGAGCAATGCTGG - Intergenic
973553380 4:52057509-52057531 CTGGGTACCCAGAGGAATGGTGG - Intronic
982839860 4:160170524-160170546 CAGTCTGCTCAGAGGAATGAGGG - Intergenic
983712992 4:170742988-170743010 CACTGTGCTAAGAGGAATGTGGG - Intergenic
985003298 4:185506534-185506556 CAGAGTGCTCCAGGGAATGGTGG - Exonic
985931722 5:3063687-3063709 CCAGGTGCTAAGAGGAGTGGAGG + Intergenic
986748346 5:10762842-10762864 CAGGGTGGCCAGAGAACTGGAGG - Intergenic
987210890 5:15682092-15682114 CAAGGTGGTCAGAGGCAGGGTGG + Intronic
988415531 5:30942445-30942467 CAGGGTACTTGGAAGAATGGTGG - Intergenic
990298793 5:54430221-54430243 TAGTGTGATCAGAGAAATGGAGG + Intergenic
990314088 5:54567796-54567818 CAGGGTGCTCTGGGCAATGCTGG - Intergenic
991923801 5:71683983-71684005 GAGGGTGGTCAGAGGCATAGGGG + Intergenic
992104740 5:73440579-73440601 CCTGGTGCTCAGTGGACTGGTGG + Intergenic
992426399 5:76662312-76662334 CAGGATAATGAGAGGAATGGAGG - Intronic
995254927 5:110035210-110035232 CTGGGTGCTCAGAAGGCTGGTGG + Intergenic
997197429 5:131989258-131989280 CAGGGTGGGAAGAGGAGTGGTGG + Intronic
997997501 5:138598273-138598295 CCGGCTGCTCTGAGGAAAGGCGG + Intergenic
999147961 5:149408133-149408155 CAGGGGACTTAGAGGAATGCAGG + Intergenic
999670856 5:153958123-153958145 GACGGTCCTCAGGGGAATGGTGG + Intergenic
1000188050 5:158880165-158880187 CTGGGTGCTCTGAGAAAGGGAGG + Intronic
1001413926 5:171529706-171529728 CAGAGCGCTCCGAGAAATGGGGG - Intergenic
1002328526 5:178425891-178425913 CATGGGGCTCAGAGGGCTGGGGG + Intronic
1003678062 6:8225290-8225312 AATGGTGCTCACAGGACTGGAGG + Intergenic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006826108 6:36937512-36937534 CAGGCAGCTCACAGGAGTGGAGG + Intergenic
1009453096 6:63824811-63824833 GAGGGTGGCCAGAGGAACGGGGG + Intronic
1012905052 6:105054682-105054704 CTAGGAGCTCTGAGGAATGGAGG + Intronic
1017054720 6:150426481-150426503 CAGTGTTCTCAGAGGAAGGAGGG + Intergenic
1017099157 6:150832197-150832219 CAGGGTGCACATACCAATGGCGG - Exonic
1018009326 6:159655363-159655385 GAGGGTGGCCAGAGGCATGGTGG + Intergenic
1018634601 6:165849657-165849679 CAGAGAGCTCAGAGGAAGTGGGG + Intronic
1018779480 6:167049372-167049394 CAGGGAGCTGAGAGGAATGGCGG - Exonic
1019895494 7:3979335-3979357 CAGGGTGCTGTTAGGAAAGGGGG - Intronic
1022525973 7:31037564-31037586 CAGGGTGCTCAGAAGAGAGATGG - Intergenic
1022802082 7:33786357-33786379 CAGGCTGCTGAGATGGATGGAGG + Intergenic
1023693944 7:42825449-42825471 CAGGAAGCTCAGAGGGGTGGGGG - Intergenic
1029362151 7:100095620-100095642 CATGGTTCTCAGGGAAATGGTGG - Intronic
1029478368 7:100798654-100798676 CAGGGCGGGCAGGGGAATGGAGG + Intergenic
1033259381 7:139829372-139829394 CTGGGGTCTCAGAGGAATGATGG + Exonic
1034466707 7:151234007-151234029 CAGGGAGCTCAGTCGCATGGTGG - Exonic
1035238697 7:157516491-157516513 CAGGGTGCTGACAGGGAGGGTGG + Intergenic
1035360532 7:158310610-158310632 CAGGCTGCGCAGGGCAATGGAGG - Intronic
1035363314 7:158328629-158328651 CTGGGTGGTGGGAGGAATGGGGG - Intronic
1035402131 7:158573234-158573256 CAAGATGTTCAGAGAAATGGAGG + Intronic
1036813078 8:11880948-11880970 CACTGTGCTCAGTGGATTGGAGG + Intergenic
1038407063 8:27329983-27330005 GACGCTGCTCAGAGTAATGGTGG - Intronic
1039839297 8:41282047-41282069 TAGGGTGACGAGAGGAATGGAGG - Intronic
1040563992 8:48549662-48549684 CAGGGTGATCAGAGACATGGAGG + Intergenic
1040614350 8:49019676-49019698 CAGGGAGCTCACAGTAATGGAGG + Intergenic
1040787860 8:51187967-51187989 CAGGCTGCACAGAGAAGTGGTGG - Intergenic
1041097718 8:54365950-54365972 CTGGGTGCTCAGAGGTAAAGGGG + Intergenic
1044264008 8:90161544-90161566 CAGGAGGCTCAGAGAAATAGAGG - Intergenic
1047879517 8:129178188-129178210 CAAGGTGGTCTGAGAAATGGTGG - Intergenic
1048979910 8:139697711-139697733 CATGGTGCTCTGAGGAGGGGTGG - Intronic
1049642687 8:143722538-143722560 TGGGGTCCTCAGAGGAGTGGAGG - Intergenic
1049690146 8:143954723-143954745 CAGGGGGCACGGAGGAATGCTGG + Intronic
1049867499 8:144948304-144948326 CAGGGTGCTCAGAGGAATGGTGG + Intronic
1053196783 9:36125954-36125976 CAGGGTGCTCACAGGACAGAGGG - Intergenic
1055670433 9:78600183-78600205 AAGAGAGCTCAGAGGATTGGTGG + Intergenic
1056655238 9:88503472-88503494 CATGATGCTCAGAGCCATGGGGG + Intergenic
1056725343 9:89109426-89109448 AAGGGTGCTCAGAGACATGATGG + Intronic
1057223186 9:93268705-93268727 CAGGGAGCTTAGAGGAAGTGGGG - Exonic
1057263237 9:93597930-93597952 CAGAGTGCCCAGAGGAGTAGAGG - Intronic
1057275427 9:93673718-93673740 CATGGTGCCCGGAAGAATGGGGG + Exonic
1059117593 9:111613553-111613575 CAGGGAGCTCACAGGCATTGTGG + Intergenic
1059412242 9:114139643-114139665 CAGGGTCCCCAGAGGAAGGGAGG + Intergenic
1059657393 9:116368933-116368955 CGGGGCGCACAGAGGAGTGGAGG - Intronic
1060222777 9:121773335-121773357 CAGGGTGCTCAGCAGGTTGGGGG - Exonic
1061372192 9:130203620-130203642 CAGGGGTCTCAGGGGACTGGGGG + Intronic
1061483476 9:130908717-130908739 CTGGGTGCTCAGTGGGTTGGGGG + Intronic
1061664618 9:132153267-132153289 CAGAGTGCTCAGAGGGGTGTAGG - Intergenic
1061887419 9:133598896-133598918 CAGGCTGCTCAGAACAAAGGTGG + Intergenic
1062009374 9:134258956-134258978 CAGGGAGCCCCGAGGCATGGGGG - Intergenic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1185544165 X:928701-928723 CTGGCTGCTCAGAGGAACTGTGG + Intergenic
1189316238 X:40058784-40058806 CTGGGAGCTCAGAGGATTGTGGG - Intronic
1195984624 X:110615439-110615461 CAGGGTGCCTAAGGGAATGGTGG - Intergenic
1197249022 X:124195277-124195299 CAGGGTGCTAAGTGCTATGGCGG - Intronic
1197953628 X:131923470-131923492 GAGGGTGGTCAGAGGAGTAGGGG + Intergenic
1200070854 X:153528457-153528479 CAGGGAGCTCAGGGGAAAGTGGG + Intronic
1200115156 X:153766766-153766788 CAGGGTGCTCAGGGCCAGGGAGG - Intronic
1200149103 X:153942788-153942810 CAGGGTGCCCAGGGGAGTGGGGG + Intronic
1200154210 X:153966786-153966808 GAGGGTGCTCAGGGGAGTGAGGG - Intronic
1201104489 Y:10753341-10753363 CATGGAGCTCACTGGAATGGAGG - Intergenic