ID: 1049876784

View in Genome Browser
Species Human (GRCh38)
Location 8:145028494-145028516
Sequence GGACCTCTGTTCTTGAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049876784_1049876786 -4 Left 1049876784 8:145028494-145028516 CCAGCTTTCAAGAACAGAGGTCC No data
Right 1049876786 8:145028513-145028535 GTCCCTGCGGCTTTCCGCAGTGG No data
1049876784_1049876789 9 Left 1049876784 8:145028494-145028516 CCAGCTTTCAAGAACAGAGGTCC No data
Right 1049876789 8:145028526-145028548 TCCGCAGTGGATTATGCCCCTGG No data
1049876784_1049876794 30 Left 1049876784 8:145028494-145028516 CCAGCTTTCAAGAACAGAGGTCC No data
Right 1049876794 8:145028547-145028569 GGTTTGTTGACTCTAGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049876784 Original CRISPR GGACCTCTGTTCTTGAAAGC TGG (reversed) Intergenic
No off target data available for this crispr