ID: 1049877654

View in Genome Browser
Species Human (GRCh38)
Location 8:145036073-145036095
Sequence CCTGCCCATGTCCTGCTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3162
Summary {0: 74, 1: 144, 2: 288, 3: 480, 4: 2176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049877654_1049877664 30 Left 1049877654 8:145036073-145036095 CCAATCAGCAGGACATGGGCAGG 0: 74
1: 144
2: 288
3: 480
4: 2176
Right 1049877664 8:145036126-145036148 CAGCCAGCAGTGGCAACCTATGG No data
1049877654_1049877658 1 Left 1049877654 8:145036073-145036095 CCAATCAGCAGGACATGGGCAGG 0: 74
1: 144
2: 288
3: 480
4: 2176
Right 1049877658 8:145036097-145036119 ACAAACAAGGGAAAAAAAGCTGG No data
1049877654_1049877659 20 Left 1049877654 8:145036073-145036095 CCAATCAGCAGGACATGGGCAGG 0: 74
1: 144
2: 288
3: 480
4: 2176
Right 1049877659 8:145036116-145036138 CTGGCCACCCCAGCCAGCAGTGG 0: 119
1: 190
2: 243
3: 344
4: 923

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049877654 Original CRISPR CCTGCCCATGTCCTGCTGAT TGG (reversed) Intergenic
Too many off-targets to display for this crispr