ID: 1049877664

View in Genome Browser
Species Human (GRCh38)
Location 8:145036126-145036148
Sequence CAGCCAGCAGTGGCAACCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049877654_1049877664 30 Left 1049877654 8:145036073-145036095 CCAATCAGCAGGACATGGGCAGG 0: 74
1: 144
2: 288
3: 480
4: 2176
Right 1049877664 8:145036126-145036148 CAGCCAGCAGTGGCAACCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049877664 Original CRISPR CAGCCAGCAGTGGCAACCTA TGG Intergenic
No off target data available for this crispr